search

COMBINE-lab / salmon

🐟 🍣 🍱 Highly-accurate & wicked fast transcript-level quantification from RNA-seq reads using selective alignment
https://combine-lab.github.io/salmon
GNU General Public License v3.0
777 stars 165 forks source link

Alevin - support for inDrop? #339

Open julietchen opened 5 years ago

julietchen commented 5 years ago

Hi, I was skimming through some of the code and other open issues on support for other library (cell barcode/umi) designs. It looks like there is code for supporting inDrop libraries, but I wasn't sure which parameters I'd need to set. I have inDrop v2 libraries that I'd like to process and am just trying to figure out if we'll need to write our own extensions or if there is already code in place that we can test.

Related to some of the comments about the best model for UMI correction in #269 The inDrop (at least the v2 protocol) is based on the CEL-Seq like chemistry -- which uses (in vitro transcription) IVT for the initial amplification rather than PCR.

From what I've seen so far, the 2 main flavors of single cell RNA-Seq library construction chemistry are

  1. CelSeq/inDrop polyA capture -> Reverse transcription (RT) for 1st strand cDNA synthesis -> 2nd strand synthesis -> IVT (linear) amplification -> fragmentation -> RT again to convert back to cDNA -> final PCR to amplify library and add Illumina adapters.

  2. DropSeq/10X polyA capture -> RT with template switching -> PCR amplification of cDNA -> fragmentation followed by variable library construction (either transposon/Nextera based or more traditional --frag, end repair, a-tail and adapter ligation) -> final PCR to amplify library and add Illumina adapters.

Thanks so much! Julie

jpcartailler commented 5 years ago

Just here to upvote support for inDrop v2 protocol 👍

mjsteinbaugh commented 5 years ago

I'm interested in this as well. Note that the (Harvard) inDrops v3 library protocol differs from v2, and is documented here: https://iccb.med.harvard.edu/files/iccb/files/sequencing_indrops_libraries_02_28_18.pdf

For reference, bcbio supports inDrops and Dropseq barcodes, but it'd be great it if we could better integrate this workflow with alevin: https://bcbio-nextgen.readthedocs.io/en/latest/contents/pipelines.html

Ankita-1211 commented 3 years ago

Is indrop supported by Alevin ?

how do I pass this (?P.{8,12})(?PGAGTGATTGCTTGTGACGCCTT)(?P.{8})(?P.{6})T{3}.* to the CLI while running Alevin.

so far I have run ddseq ((?P.{6})(?PTAGCCATCGCATTGC)(?P.{6})(?PTACCTCTGAGCTGAA)(?P.{6})(?PACG)(?P.{8}).*) using these params for Alevin --bc-geometry 1[1-6,22-28,44-49] --umi-geometry 1[53-60] --read-geometry 2[1-end]

I am novice in scRNA data analysis. Need your help. @k3yavi