indelqual 'unknown op 3 for read' error

CSB5 / lofreq

LoFreq Star: Sensitive variant calling from sequencing data

http://csb5.github.io/lofreq/

Other

100 stars 30 forks source link

indelqual 'unknown op 3 for read' error #103

Open mattdoug604 opened 4 years ago

mattdoug604 commented 4 years ago

Hi, I'm running LoFreq 2.1.5 with the command:

lofreq indelqual --dindel --ref hg19a.fa --out indelqual.bam <my_bam>

but I'm getting an error:


FATAL(lofreq_indelqual.c|dindel_fetch_func:195): unknown op 3 for read EXAMPLE:4:1112:9354:2891

I pulled out the read the error references:

EXAMPLE:4:1112:9354:2891   177     1       14757   0       73M966N2M       15      102516464       0       GGGATGGAGTCTGACACGCGGGCAAAGGCTCCTCCGGGCCCCTCACCAGCCCCAGGTCCTTTCCCAGAGATGCCT     JJJA-JFAJJJFJJJJJJJJJFAJJJJJJJJJJF7FAFAJJJJFJJFJJJJJJJJJJJJJJJJJJJJJFJFAAAA  MD:Z:75 PG:Z:MarkDuplicates     RG:Z:244717     ZJ:Z:14830-15795        NM:i:0  AS:i:75 XS:i:75

I'm not sure what the issue is though.

andreas-wilm commented 4 years ago

Hi Matt, apologies for the late reply. lofreq indelqual can't deal with refskips (N in cigars). That's something I can build in though. I'm lacking a good example. Would you mind to send me a BAM with this (and ideally other similar) reads? Please do let me know which reference sequence you used. Mind telling me which mapper you used for this alignment? Many thanks

mattdoug604 commented 3 years ago

Hi Andreas, it would be super helpful to build in support for refskips.

I've attached a example BAM file with the kind of alignments I'm dealing with: example.bam.zip

The reference I use is this one: http://www.bcgsc.ca/downloads/genomes/9606/hg19/1000genomes/bwa_ind/genome/GRCh37-lite.fa

The aligner is bwa-mem (version 0.7.6a).

Thanks!

franrodalg commented 3 years ago

Hi Andreas, I'm experiencing the same issue. Is there any way to ignore refskips, be within LoFreq or as a pre-processing step, that you are aware of?

Cheers, Fran

mattdoug604 commented 3 years ago

Hi @andreas-wilm, Has there been any progress on this issue?

Cheers, Matt

andreas-wilm commented 3 years ago

I haven't found the time yet to work on this. Apologies

mattdoug604 commented 3 years ago

Hi, I just wanted to let you know I'm still interested in a fix for this.

andreas-wilm commented 3 years ago

Thanks Matt. I fear this might take some more time as I'm maintaining LoFreq as a hobby.

Andreas

On Thu, 15 Apr 2021 at 02:01, Matt Douglas @.***> wrote:

Hi, I just wanted to let you know I'm still interested in a fix for this.

— You are receiving this because you were mentioned. Reply to this email directly, view it on GitHub https://github.com/CSB5/lofreq/issues/103#issuecomment-819721395, or unsubscribe https://github.com/notifications/unsubscribe-auth/AAILSCOT2HIXEKYKFYBNKRLTIXJ6FANCNFSM4R2LQYOA .

-- Andreas Wilm @.*** | 0x7C68FBCC

GoncheDanesh commented 12 months ago

Hi,

Were you able to find a solution @andreas-wilm or @mattdoug604 to bypass this issue? I am encountering the same issue here.

Thanks in advance

andreas-wilm commented 11 months ago

Apologies. I only don't really maintain LoFreq anymore. The root cause are refskips in your alignment (N in cigars). There are really only two options (other than implementing this in the code): don't predict indels i.e. skip the indelqual step or change the aligner. Sorry