Closed hyeon9 closed 4 months ago
Hi @hyeon9,
A couple of things:
Having strange characters in your identifiers can always be problematic, regardless of the software tool you use. My suggestion would be to re-format your IDs to convert them to a simpler string, and see if the issue persists.
Ángeles
Hi Ángeles,
I've tested SQANTI3 filtering with simple ID, such as ONT.x. This format worked well. I believe an unusual ID result from BLAZE has caused this error to occur.
Thank you, Hyeongu
Is there an existing issue for this?
Have you loaded the SQANTI3.env conda environment?
Problem description
Hi SQANTI3 team, Thank you for your shiny tool for long read data !
Recently, I've faced some error. When I used nanopore data in SQANTI filtering step, I got below error message.
Error in scan(file = file, what = what, sep = sep, quote = quote, dec = dec, : line 10 did not have 48 elements Calls: read.table -> scan
When I checked my classification.txt file, all line has 48 elements. I think their isoform_id might be problematic because they don't have "." in their isoform_id. "AAACCCAAGACATACAGGTTCCAACAGA#a7cf31cf-5340-4250-8212-ba013dc50e80+-0".
If my guess is right, could you please add appropriate mode for nanopore data?
Thank you, Hyeongu
Code sample
conda activate ./miniconda3/envs/SQANTI3.env
code_dir="/Tool/SQANTI3-5.1.1/" params=$1 json=$2 input="inputs/" out="outputs/" code_dir="SQANTI3-5.1.1/"
for i in Std_1st_SQANTI3 2hr-test1_1st_SQANTI3 2hr-test2_1st_SQANTI3 do python ${code_dir}sqanti3_filter.py rules \ -o ${params} \ -d ${out}${i}/${params}_filtering \ --gtf ${out}${i}/1st_SQANTI3_corrected.gtf \ --isoforms ${out}${i}/1st_SQANTI3_corrected.fasta \ -j ${json} \ ${out}${i}/1st_SQANTI3_classification.txt done
Error
Error in scan(file = file, what = what, sep = sep, quote = quote, dec = dec, : line 10 did not have 48 elements Calls: read.table -> scan Execution halted
Anything else?
No response