Hi, I am using HISAT2 for alignment and further variant calling using GATK. But, I am not getting any vcf file with the following input files.
Here is my process of running HISAT2:
3 reads; of these:
3 (100.00%) were unpaired; of these:
0 (0.00%) aligned 0 times
3 (100.00%) aligned exactly 1 time
0 (0.00%) aligned >1 times
100.00% overall alignment rate
Input file:
KF267450.1 one
TTAAAAGAGATTTTCTATCTACGGATAGTTAGCTCTTTTTCTAGACTCTTGTCTACTCAATTCAACTAAA
KF267450.1 two
ACAAACAGCCTTCCTCCGGTTCCGTCTGGGGGTTGTGTGGATAACTAGTTCTGTCTAGTTTGAAACCAGT
KF267450.1 three
TATGAGCATACTTTTCCTGATGGTACTGCCATGAAGGTTGCACGTACTCCAAAGATTAAGAAGACTGTTG
CATGCTCTGCTACGCCTGGTTCTGTTGTGGTTACGCGCGCTGGTGCTGGCACTGGTGTTAAGTATTACAA
Hi, I am using HISAT2 for alignment and further variant calling using GATK. But, I am not getting any vcf file with the following input files. Here is my process of running HISAT2:
Command: RG="@RG\tID:XX.L001\tSM:1\tPL:ILLUMINA\tLB:lib501\tPU:XX.1.NoIndex"
./hisat2 --rg-id $RG -f -x ../hisat-trt/PEDV -U ../clean_trt.fasta -S ../trt.sam
log message:
3 reads; of these: 3 (100.00%) were unpaired; of these: 0 (0.00%) aligned 0 times 3 (100.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 100.00% overall alignment rate Input file:
reference file:
GATK command: ./gatk HaplotypeCaller -R ../sequence.fasta -I ../sorted-trt.bam.bai -O ../variants-trt.vcf