search

Dobbs-Lab / GTagHD

A repository for the GTagHD Web Tool
GNU General Public License v3.0
0 stars 1 forks source link

Connection issue using ensembl id #7

Open gungne opened 4 years ago

gungne commented 4 years ago

Not sure if it has to do with recent Ensembl updates...

Load Shiny in the R/RStudio Environment

library(shiny)

Retrieve, load, and run GTagHD from GitHub

runGitHub("GTagHD", "Dobbs-Lab") Downloading https://github.com/Dobbs-Lab/GTagHD/archive/master.tar.gz

Listening on http://127.0.0.1:3396 Error in isEnsemblUp: Service Unavailable (HTTP 503). 78:

Or an alternative version: Listening on http://127.0.0.1:3396 Error in : $ operator is invalid for atomic vectors 76: processEnsTranscript [ensemblAccessoryFunctions.R#469] 75: handleEnsemblInput [ensemblAccessoryFunctions.R#16] 74: observeEventHandler [/private/var/folders/jv/nm02b8xj0cqdn5nswwps597m0000gn/T/RtmpKSAk4d/shinyappc161454107bb/GTagHD-master/server.R#640] 3: runApp 2: runUrl 1: runGitHub

cmmann commented 4 years ago

Hi @gungne ,

I've been unable to reproduce this issue; it is very possible that Ensembl was temporarily down while you were attempting to use it (we've had that issue very frequently in the past). Could you try again and let me know if the issue is still persisting?

gungne commented 4 years ago

@cmmann Thanks for the quick response! Actually I have tried some previous design and seems to be working... It's probably something weird with one particular transcript: GGATTCAGACAGGATGCACC and ENSDART00000013148.7 Still wondering why it's not working... The webpage version responded in a similar way.

cmmann commented 4 years ago

@gungne , I have been able to reproduce this issue; for some reason, the data associated with your transcript ID is causing R to, in technical terms, throw up when it attempts to format that data into a data frame. I'm still not sure what about the data is causing this issue, and I have not yet been able to figure out a fix, but I'll be working on this and will hopefully have something for you in the next couple of days.