search

EfresBR / G4iMGrinder

G4-iM Grinder is a fast, robust and highly adaptable algorithm. It is capable of locating, identifying, qualifying and quantifying DNA and RNA potential quadruplex structures, such as G-quadruplex, i-Motifs and their higher order versions.
GNU General Public License v3.0
7 stars 3 forks source link

Running on shorter sequences fails #1

Closed omarwagih closed 5 years ago

omarwagih commented 5 years ago

I'm trying to predict G-quadruplexes in shorter sequences e.g. 

G4iMGrinder(Name ="test", Sequence = 'AACAGAGGAAGGGGAGGGGC')

but I get:

Error in `[<-.data.frame`(`*tmp*`, , i, value = c(NA, 8L, NA)) : 
  replacement has 3 rows, data has 1
Timing stopped at: 0.003 0 0.003
EfresBR commented 5 years ago

Current version (V1.5.5) fixes the analysis of smaller sequences, and other minor bugs. Please re-install the package and execute the code.

When: 

Rs <- G4iMGrinder::G4iMGrinder(Name ="test", Sequence = 'AACAGAGGAAGGGGAGGGGC')

you will receive an error as the number or runs detected are not enough to build a quadruplex.

 Error: M1B found no related runs on sequence, or they are not enough to build a quadruplex (rRuns < MinNRuns).

To accommodate the search for potential 3 run sequences, modify the variable 'min number of runs needed to define a Quadruplex' (MinNRuns):

Rs <- G4iMGrinder::G4iMGrinder(Name ="test", Sequence = 'AACAGAGGAAGGGGAGGGGC', MinNRuns = 3)