there's no output result

[Shineshine]

I used the following commands to run bismark: /PUBLIC/software/RNA/bismark/bismark_v0.12.5/bismark -u 50000 -q --bowtie2 -p 4 --prefix map --path_to_bowtie /PUBLIC/software/RNA/bowtie2-2.2.5 -o map_test/default -1 sample_1.clean.fq -2 sample_2.clean.fq I have waited for eight hours,but there's no any results in the output directory and no error message.I wonder if anyone has meet the problem. Thanks.

[FelixKrueger]

You should start to see the first output files withing a few seconds of starting the run, so something is fishy here. Is there a specific reason why you are using a Bismark version that is more 10 releases outdated? I would suggest you update to the latest version (git clone to get the latest one), rerun your command and send me the exact output of what is going on onscreen via email if it still fails? Best, Felix

[Shineshine]

Hi, Felix

I used the latest vesion and tried again,but it still no works. There is no results in the output directory. After the run for one minute,the log file shows as follows and it stays the same：

Have you met the situation, I'll apppreciate your help! best,shine

------------------ Original ------------------ From: "FelixKrueger"notifications@github.com; Date: Tue, Mar 15, 2016 07:12 PM To: "FelixKrueger/Bismark"Bismark@noreply.github.com; Cc: "Shineshine"lishan@novogene.com; Subject: Re: [Bismark] there's no output result (#34)

You should start to see the first output files withing a few seconds of starting the run, so something is fishy here. Is there a specific reason why you are using a Bismark version that is more 10 releases outdated? I would suggest you update to the latest version (git clone to get the latest one), rerun your command and send me the exact output of what is going on onscreen via email if it still fails? Best, Felix

— You are receiving this because you authored the thread. Reply to this email directly or view it on GitHub: https://github.com/FelixKrueger/Bismark/issues/34#issuecomment-196768322

[FelixKrueger]

You are doing something wrong, but its very difficult to guess what it might be from the blank line you provided :) As I have pointed out already you need to send me the exact commands and output of what is going on onscreen (probably best via email to felix.krueger@babraham.ac.uk) in order to get an idea of the underlying cause.

[Shineshine]

Hi, Felix Sorry, the information provided before is not very complete. The sample I analysis is Drosophila_melanogaster, the reference genome is downloaded from Ensembl and the version is BDGP5.23. The commands I used is as follows: perl /ifs/TJPROJ3/RNA/lishan/software/bismark/Bismark-0.15.0/bismark -u 100 -q --bowtie2 -p 4 --prefix map \ --path_to_bowtie /PUBLIC/software/RNA/bowtie2-2.2.3/ \ -o map_test/default \ /ifs/TJPROJ3/RNA/Guoying_WGBS/genome \ -1 DR_1_1.clean.fq \ -2 DR_1_2.clean.fq

The output on screen is : Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/PUBLIC/software/public/VarCall/samtools/samtools-0.1.18/samtools' Reference genome folder provided is /ifs/TJPROJ3/RNA/Guoying_WGBS/genome/ (absolute path is '/ifs/TJPROJ3/RNA/Guoying_WGBS/genome/)' FastQ format specified Processing sequences up to read no. 100 from the input file Each Bowtie 2 instance is going to be run with 4 threads. Please monitor performance closely and tune down if needed! Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!) Output will be written into the directory: /ifs/TJPROJ3/RNA/lishan/Bismark/map_test/default/ Using the following prefix for output files: map

Setting parallelization to single-threaded (default)

Current working directory is: /ifs/TJPROJ3/RNA/lishan/Bismark

Now reading in and storing sequence information of the genome specified in: /ifs/TJPROJ3/RNA/Guoying_WGBS/genome/

chr dmel_mitochondrion_genome (19517 bp) chr XHet (204112 bp) chr YHet (347038 bp) chr 2LHet (368872 bp) chr 4 (1351857 bp) chr 3RHet (2517507 bp) chr 3LHet (2555491 bp) chr 2RHet (3288761 bp) chr U (10049037 bp) chr 2R (21146708 bp) chr X (22422827 bp) chr 2L (23011544 bp) chr 3L (24543557 bp) chr 3R (27905053 bp) chr Uextra (29004656 bp)

Single-core mode: setting pid to 1

Paired-end alignments will be performed

The provided filenames for paired-end alignments are DR_1_1.clean.fq and DR_1_2.clean.fq Input files are in FastQ format Processing reads up to sequence no. 100 from DR_1_1.clean.fq Writing a C -> T converted version of the input file DR_1_1.clean.fq to map.DR_1_1.clean.fq_C_to_T.fastq

Created C -> T converted version of the FastQ file DR_1_1.clean.fq (101 sequences in total)

Processing reads up to sequence no. 100 from DR_1_2.clean.fq Writing a G -> A converted version of the input file DR_1_2.clean.fq to map.DR_1_2.clean.fq_G_to_A.fastq

Created G -> A converted version of the FastQ file DR_1_2.clean.fq (101 sequences in total)

Input files are map.DR_1_1.clean.fq_C_to_T.fastq and map.DR_1_2.clean.fq_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /ifs/TJPROJ3/RNA/Guoying_WGBS/genome/ with the specified options: -q --score-min L,0,-0.2 -p 4 --reorder --ignore-quals --no-mixed --no-discordant --maxins 500

Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from map.DR_1_1.clean.fq_C_to_T.fastq and map.DR_1_2.clean.fq_G_to_A.fastq, with the options: -q --score-min L,0,-0.2 -p 4 --reorder --ignore-quals --no-mixed --no-discordant --maxins 500 --norc)) Found first alignment: ST-E00317:101:HLFVJCCXX:2:1101:9709:1784_1:N:0:ACTTGA/1 77 * 0 0 * * 0 0 NTTTTTTTATATTTGTGGTATTTATGTTTGGGGTGAGGATAAGTGGAATATTGTTTGTTGATTTTTTAGTTTTGTAGTTAGTTTATTTTTTGGTTAGGAATTTATATTATTTTAATTTTAGGTGT #AAFFKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKFFKFKKKKFKK7KKKAKKKFFKFKKKKKKFKKKKKKKKFFAFFFAFKKKKKFKKKKKKKKFKKKFKKFKKKKKKKK<FAFKKKFFKK YT:Z:UP ST-E00317:101:HLFVJCCXX:2:1101:9709:1784_2:N:0:ACTTGA/2 141 0 0 * 0 0 ATCCCCTATCAACAATAAATTCAATCCAAAATACAAATAATAACAACTTTTACCCCAACAAAATACAATCACTAATAACACAACATACACCTAAAATTAAAATAATATAAATTCCTAACCAAAAA AAFFFKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKK7KKKKKKKKKKKKKKKKK<FAKFFK<AKKFFK YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from map.DR_1_1.clean.fq_C_to_T.fastq and map.DR_1_2.clean.fq_G_to_A.fastq, with the options: -q --score-min L,0,-0.2 -p 4 --reorder --ignore-quals --no-mixed --no-discordant --maxins 500 --nofw)) 100 reads; of these: 100 (100.00%) were paired; of these: 56 (56.00%) aligned concordantly 0 times 29 (29.00%) aligned concordantly exactly 1 time 15 (15.00%) aligned concordantly >1 times 44.00% overall alignment rate

But it remains the same and the program seems to be stuck. Hope these can give you some clues. Best, shine

------------------ Original ------------------ From: "FelixKrueger"notifications@github.com; Date: Fri, Mar 18, 2016 06:01 PM To: "FelixKrueger/Bismark"Bismark@noreply.github.com; Cc: "Shineshine"lishan@novogene.com; Subject: Re: [Bismark] there's no output result (#34)

You are doing something wrong, but its very difficult to guess what it might be from the blank line you provided :) As I have pointed out already you need to send me the exact commands and output of what is going on onscreen (probably best via email to felix.krueger@babraham.ac.uk) in order to get an idea of the underlying cause.

— You are receiving this because you authored the thread. Reply to this email directly or view it on GitHub

[FelixKrueger]

This is an odd error message. The processing seems to start as you would expect until it starts the second alignment thread: Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from map.DR_1_1.clean.fq_C_to_T.fastq and map.DR_1_2.clean.fq_G_to_A.fastq, with the options: -q --score-min L,0,-0.2 -p 4 --reorder --ignore-quals --no-mixed --no-discordant --maxins 500 --nofw))

However it doesn't report the first alignment it found, which shouldn't take more than a couple of seconds at most. This leads me to believe that the Bowtie 2 indexes are corrupted, especially the GA_conversion one. Can you go and list the files and file sizes in the CT_conversion and GA_conversion folders? They should match up to the byte, if they are not then something went wrong with the indexing, and Bowtie2 seems stuck finding any alignments (would really be a Bowtie2 bug if it didn't die because of this...).

If that was the case could you just re-run the indexing and try again?

[FelixKrueger]

any update on this?

[Shineshine]

Yeah, I rebuilt the index and it works. Thank you so much !

---

      李珊                                               生物信息工程师                    
                      科技服务部                  
                                      北京诺禾致源生物信息科技有限公司                      
                                                                                                            电话：                   400-966-0802                
                                手机：                   18614084835                 
                                邮箱：                   lishan@novogene.com

                                网址：                    www.novogene.com               
                                地址：                   北京市海淀区金码大厦B座17层                 

                天津市武清区创业总部基地B07栋

------------------ Original ------------------ From: "FelixKrueger"notifications@github.com; Date: Wed, Apr 13, 2016 06:03 PM To: "FelixKrueger/Bismark"Bismark@noreply.github.com; Cc: "Shineshine"lishan@novogene.com; Subject: Re: [FelixKrueger/Bismark] there's no output result (#34)

any update on this?

— You are receiving this because you authored the thread. Reply to this email directly or view it on GitHub

[FelixKrueger]

Excellent, thanks for letting me know.

[seppalai]

Hey I have had the same problem with running Bismark, it converts my fastq reads to the CT-version and then starts the alignment but never gets anywhere, the bam-file stays empty. I have built the indices again and there is no change. Here is what I get from Bismark:

Single-core mode: setting pid to 1

Single-end alignments will be performed

Input file is in FastQ format Writing a C -> T converted version of the input file ENCFF000MGRN.fastq.gz to ENCFF000MGRN.fastq.gz_C_to_T.fastq

Created C -> T converted version of the FastQ file ENCFF000MGRN.fastq.gz (53253520 sequences in total)

Input file is ENCFF000MGRN.fastq.gz_C_to_T.fastq (FastQ)

Now running 2 instances of Bowtie 2 against the bisulfite genome of /wrk/seppalai/genomes/hg38/ with the specified options: -q --score-min L,0,-0.2 --ignore-quals

Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from ENCFF000MGRN.fastq.gz_C_to_T.fastq with options -q --score-min L,0,-0.2 --ignore-quals --norc) Using Bowtie 2 index: /wrk/seppalai/genomes/hg38/Bisulfite_Genome/CT_conversion/BS_CT

Found first alignment: HWI-EAS149_5:5:1:996:18136:0:1:0 4 * 0 0 * * 0 0 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB YT:Z:UU YF:Z:NS Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from ENCFF000MGRN.fastq.gz_C_to_T.fastq with options -q --score-min L,0,-0.2 --ignore-quals --nofw) Using Bowtie 2 index: /wrk/seppalai/genomes/hg38/Bisulfite_Genome/GA_conversion/BS_GA

Found first alignment: HWI-EAS149_5:5:1:996:18136:0:1:0 4 * 0 0 * * 0 0 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB YT:Z:UU YF:Z:NS

Writing bisulfite mapping results to ENCFF000MGR_N__bismark_bt2.bam <<<

Reading in the sequence file ENCFF000MGRN.fastq.gz

I'm using the hg38 version with all of the haplotypes and unplaced contigs, might that have something to do with the problem?

[FelixKrueger]

Hi there, am I right in assuming that this file is RRBS data from https://www.encodeproject.org/experiments/ENCSR439FXM/? It could be that the file is still using the old Phred64 encoding seeing that there are tons of BBBBBB quality scores. Could you verify this using FastQC and if so use the option --phred64 when launching Bismark?

As next step could you maybe sub-sample the file by using e.g. -u 1000 or so to see if that completes? If you could also let me know where you downloaded the genome I could give it a go over here and report back on the status. Cheers, Felix

[FelixKrueger]

I just got the data, and it is really odd because the sequences look like this:

@HWI-EAS149_5:5:1:18084:18792:0:1:0
....................................
+
BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
@HWI-EAS149_5:5:1:18086:17494:0:1:0
....................................
+
BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
@HWI-EAS149_5:5:1:18088:18452:0:1:0
....................................
+
BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
@HWI-EAS149_5:5:1:18097:12780:0:1:0
....................................
+
BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB

I haven't seen Illumina data so far where . were used as sequence to be honest.

Also, the data is indeed in the Illumina 1.5 encoding and thus needs --phred64 to be run properly. I am suspecting that Bowtie2 converts all the ..... in the sequences to N, but this might cause a problem within Bismark later on. I will try writing a little script to replace all dots with 'N' to see if that makes a difference. By the way, aligning the data to the GRCh38 genome with a subset of 100000 sequences completed fine:

Successfully deleted the temporary file ENCFF000MGR.fastq.gz_C_to_T.fastq

Final Alignment report
======================
Sequences analysed in total:    100000
Number of alignments with a unique best hit from the different alignments:      31889
Mapping efficiency:     31.9%

Sequences with no alignments under any condition:       40971
Sequences did not map uniquely: 27140
Sequences which were discarded because genomic sequence could not be extracted: 0

Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT:  16519   ((converted) top strand)
CT/GA:  15370   ((converted) bottom strand)
GA/CT:  0       (complementary to (converted) top strand)
GA/GA:  0       (complementary to (converted) bottom strand)

Number of alignments to (merely theoretical) complementary strands being rejected in total:     0

Final Cytosine Methylation Report
=================================
Total number of C's analysed:   338532

Total methylated C's in CpG context:    31337
Total methylated C's in CHG context:    554
Total methylated C's in CHH context:    1047
Total methylated C's in Unknown context:        0

Total unmethylated C's in CpG context:  54922
Total unmethylated C's in CHG context:  81717
Total unmethylated C's in CHH context:  168955
Total unmethylated C's in Unknown context:      0

C methylated in CpG context:    36.3%
C methylated in CHG context:    0.7%
C methylated in CHH context:    0.6%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0

[seppalai]

Thank you Felix! That is indeed the right data set. I'm just going to run Bismark with the --phred64. I did myself already convert the data so that the dots "." are replaced by "N"s. I'll let you know if this works!

[seppalai]

Using the --phred64-quals option doesn't seem to solve the problem, the outfile.bam is still empty and there is no error message. I tried this both on the unchanged data and the version where I changed the dots to Ns.

[FelixKrueger]

Right, on my side it seems to be working fine, completed 11 Mio sequences in ~half an hour so far. It also shows that the . to N conversion is not techically required for Bismark to work fine.

It could now be a genome issue or it might have to do with your version of Samtools, Bowtie 2, Bismark or system resources? Could you try using a different genome maybe without all the haplotypes and so on?

[seppalai]

Hey Felix, it seems that the problem was indeed with the system resources not with Bismark! With the --phred64-quals option and the correct amount of allocated memory the analysis seems to now be running fine. With one of the files in the data set I do get the following message:

Reading in the sequence file ENCFF000MGSN.fastq.gz Chromosomal sequence could not be extracted for ILLUMINA-8B1BB3_4:5:3:7462:19626:0:1:1 chrM 1 Processed 1000000 sequences so far Chromosomal sequence could not be extracted for ILLUMINA-8B1BB3_4:5:8:17076:8150:0:1:1 chrM 1 Processed 2000000 sequences so far Chromosomal sequence could not be extracted for ILLUMINA-8B1BB3_4:5:9:14901:5514:0:1:1 chrM 1 Processed 3000000 sequences so far Chromosomal sequence could not be extracted for ILLUMINA-8B1BB3_4:5:15:3837:12496:0:1:1 chrM 1 Processed 4000000 sequences so far Processed 5000000 sequences so far Chromosomal sequence could not be extracted for ILLUMINA-8B1BB3_4:5:22:4283:9596:0:1:1 chrM 1 Processed 6000000 sequences so far Processed 7000000 sequences so far Chromosomal sequence could not be extracted for ILLUMINA-8B1BB3_4:5:29:12261:1996:0:1:1 chrM 1

and I don't really know what that means. With the other three files such a message has not presented itself. Is this due to some reads that have only "N"s in them? Thank you again!

[FelixKrueger]

Hi Ippa,

That's great to hear! The "chromosomal sequence couldn't be extracted" warning may occur occasionally but this is not normally anything you should worry about, see e.g. here: https://github.com/FelixKrueger/Bismark/issues/35.

[bhagya-ct]

Hello Felix,

I encored following problem.

Genome was indexed using following command.

bismark_genome_preparation --bowtie2 genome_folder/

Paired end alignment

bismark -n 1 genome_folder/ -1 SRR653495_1.fastq -2 SRR653495_2.fastq Path to Bowtie 2 specified as: bowtie2 Bowtie seems to be working fine (tested command 'bowtie2 --version' [2.2.6]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/usr/local/bin/samtools' Reference genome folder provided is genome_folder/ (absolute path is '/media/mml/VICKY/Sequencing data/Magnaporthe/Bisulfite/genome_folder/)' FastQ format assumed (by default)

Input files to be analysed (in current folder '/media/mml/VICKY/Sequencing data/Magnaporthe/Bisulfite'): SRR653495_1.fastq SRR653495_2.fastq Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!) Setting parallelization to single-threaded (default)

Current working directory is: /media/mml/VICKY/Sequencing data/Magnaporthe/Bisulfite

Now reading in and storing sequence information of the genome specified in: /media/mml/VICKY/Sequencing data/Magnaporthe/Bisulfite/genome_folder/

chr 1 (7978604 bp) chr 2 (8319966 bp) chr 3 (6606598 bp) chr 4 (5546968 bp) chr 5 (4490059 bp) chr 6 (4133993 bp) chr 7 (3415785 bp) chr supercont8.8 (535760 bp)

Single-core mode: setting pid to 1

Paired-end alignments will be performed

The provided filenames for paired-end alignments are SRR653495_1.fastq and SRR653495_2.fastq Input files are in FastQ format Writing a C -> T converted version of the input file SRR653495_1.fastq to SRR653495_1.fastq_C_to_T.fastq

Created C -> T converted version of the FastQ file SRR653495_1.fastq (10678389 sequences in total)

Writing a G -> A converted version of the input file SRR653495_2.fastq to SRR653495_2.fastq_G_to_A.fastq

Created G -> A converted version of the FastQ file SRR653495_2.fastq (10678389 sequences in total)

Input files are SRR653495_1.fastq_C_to_T.fastq and SRR653495_2.fastq_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /media/mml/VICKY/Sequencing data/Magnaporthe/Bisulfite/genome_folder/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500

Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from SRR653495_1.fastq_C_to_T.fastq and SRR653495_2.fastq_G_to_A.fastq, with the options: -q -N 1 --score-min L,0,-0.2 --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Warning: Output file 'data/Magnaporthe/Bisulfite/genome_folder/Bisulfite_Genome/CT_conversion/BS_CT' was specified without -S. This will not work in future Bowtie 2 versions. Please use -S instead. Error: Could not open alignment output file data/Magnaporthe/Bisulfite/genome_folder/Bisulfite_Genome/CT_conversion/BS_CT Error: Encountered internal Bowtie 2 exception (#1) Command: /usr/bin/bowtie2-align-s --wrapper basic-0 -q -N 1 --score-min L,0,-0.2 --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc -x /media/mml/VICKY/Sequencing -1 SRR653495_1.fastq_C_to_T.fastq -2 SRR653495_2.fastq_G_to_A.fastq data/Magnaporthe/Bisulfite/genome_folder/Bisulfite_Genome/CT_conversion/BS_CT (ERR): bowtie2-align exited with value 1 Found no alignment, assigning undef to last_seq_id and last_lines Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from SRR653495_1.fastq_C_to_T.fastq and SRR653495_2.fastq_G_to_A.fastq, with the options: -q -N 1 --score-min L,0,-0.2 --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Warning: Output file 'data/Magnaporthe/Bisulfite/genome_folder/Bisulfite_Genome/GA_conversion/BS_GA' was specified without -S. This will not work in future Bowtie 2 versions. Please use -S instead. Error: Could not open alignment output file data/Magnaporthe/Bisulfite/genome_folder/Bisulfite_Genome/GA_conversion/BS_GA Error: Encountered internal Bowtie 2 exception (#1) Command: /usr/bin/bowtie2-align-s --wrapper basic-0 -q -N 1 --score-min L,0,-0.2 --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw -x /media/mml/VICKY/Sequencing -1 SRR653495_1.fastq_C_to_T.fastq -2 SRR653495_2.fastq_G_to_A.fastq data/Magnaporthe/Bisulfite/genome_folder/Bisulfite_Genome/GA_conversion/BS_GA (ERR): bowtie2-align exited with value 1 Found no alignment, assigning undef to last_seq_id and last_lines

Writing bisulfite mapping results to SRR653495_1_bismark_bt2_pe.bam <<<

Reading in the sequence files SRR653495_1.fastq and SRR653495_2.fastq Processed 1000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 4000000 sequence pairs so far Processed 5000000 sequence pairs so far Processed 6000000 sequence pairs so far Processed 7000000 sequence pairs so far Processed 8000000 sequence pairs so far Processed 9000000 sequence pairs so far Processed 10000000 sequence pairs so far Processed 10678389 sequences in total

Successfully deleted the temporary files SRR653495_1.fastq_C_to_T.fastq and SRR653495_2.fastq_G_to_A.fastq

Final Alignment report

Sequence pairs analysed in total: 10678389 Number of paired-end alignments with a unique best hit: 0 Mapping efficiency: 0.0%

Sequence pairs with no alignments under any condition: 10678389 Sequence pairs did not map uniquely: 0 Sequence pairs which were discarded because genomic sequence could not be extracted: 0

Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 0 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 0 ((converted) bottom strand)

Number of alignments to (merely theoretical) complementary strands being rejected in total: 0

Final Cytosine Methylation Report

Total number of C's analysed: 0

Total methylated C's in CpG context: 0 Total methylated C's in CHG context: 0 Total methylated C's in CHH context: 0 Total methylated C's in Unknown context: 0

Total unmethylated C's in CpG context: 0 Total unmethylated C's in CHG context: 0 Total unmethylated C's in CHH context: 0 Total unmethylated C's in Unknown context: 0

Can't determine percentage of methylated Cs in CpG context if value was 0 Can't determine percentage of methylated Cs in CHG context if value was 0 Can't determine percentage of methylated Cs in CHH context if value was 0 Can't determine percentage of methylated Cs in unknown context (CN or CHN) if value was 0

Bismark completed in 0d 0h 3m 26s

==================== Bismark run complete

Thanks Bhagya C T

[FelixKrueger]

Hi Bhaya,

The important error messge seems to be

Warning: Output file 'data/Magnaporthe/Bisulfite/genome_folder/Bisulfite_Genome/CT_conversion/BS_CT' was specified without -S. This will not work in future Bowtie 2 versions. Please use -S instead.
Error: Could not open alignment output file data/Magnaporthe/Bisulfite/genome_folder/Bisulfite_Genome/CT_conversion/BS_CT
Error: Encountered internal Bowtie 2 exception (#1)

May I ask which version of Bismark you were running? Could you also link the exact command you used for Bismark?

And lastly, I would advise running the SRR files through Trim Galore first to remove adapter contamination, but let's first get to the bottom of went wrong with the command.

[bhagya-ct]

Hi Felix,

Version information:

Bismark - Bisulfite Mapper and Methylation Caller.

                   Bismark Version: v0.18.2
    Copyright 2010-17 Felix Krueger, Babraham Bioinformatics
          www.bioinformatics.babraham.ac.uk/projects/
            https://github.com/FelixKrueger/Bismark

command used:

bismark -n 1 genome_folder/ -1 SRR653495_1.fastq -2 SRR653495_2.fastq

Quality checking, adaptor and poor base trimming I will do, this is the first time I am working with bisulfite reads so trying to establish the pipeline first.

[FelixKrueger]

PS: Your installation of Bowtie2 is also over two years old. Can you please update to the latest version and see if that has an effect (I would like to avoid chasing errors that may no longer be there...). Cheers, Felix

[FelixKrueger]

OK, that sounds alright. Next up would be the latest version of Bowtie 2 then. F.

[bhagya-ct]

Sure, I will fix that ASAP. Thank you.