ERROR: parameter -L not recognized

[DanielaMombach]

I'm trying to run the vignette and this error appears, below is my command and the issue

bash /home/dani/software/ExplorATE_shell_script/ExplorATE mo -p8 -b /usr/bin/bedtools -s /usr/bin/salmon -f hg38.p13.fa -g hg38.refGene.gtf -r hg38.p13.fa.out -e pe -l reads/ -o out_mo
=============================
|||       ExplorATE       |||
=============================
-p <threads> = 8
-b <bedtools binary> = /usr/bin/bedtools
-s <salmon path> = /usr/bin/salmon
-f <fasta genome> = /mnt/d/explorate/hg38.p13.fa
-g <gtf genome> = /mnt/d/explorate/hg38.refGene.gtf
-r <RepeatMasker file> = /mnt/d/explorate/hg38.p13.fa.out
-e <libraries format 'pe' | 'se'> = pe
-l <fastq libraries path> = /mnt/d/explorate/reads
-o <Output files Path> = /mnt/d/explorate/out_mo

Making TEs references
=====================
---------------------------
Genomic features processing
---------------------------
[2022-08-26 10:29:58][INFO] recording chromosome lengths...
[2022-08-26 10:31:40][INFO] Extracting introns, UTRs and intergenic regions

Tool:    bedtools complement (aka complementBed)
Version: v2.27.1
Summary: Returns the base pair complement of a feature file.

Usage:   bedtools complement [OPTIONS] -i <bed/gff/vcf> -g <genome>

Notes:
        (1)  The genome file should tab delimited and structured as follows:
             <chromName><TAB><chromSize>

        For example, Human (hg19):
        chr1    249250621
        chr2    243199373
        ...
        chr18_gl000207_random   4262

Tips:
        One can use the UCSC Genome Browser's MySQL database to extract
        chromosome sizes. For example, H. sapiens:

        mysql --user=genome --host=genome-mysql.cse.ucsc.edu -A -e \
        "select chrom, size from hg19.chromInfo"  > hg19.genome

***** ERROR: Unrecognized parameter: -L *****

===============
/// ABORTED ///
===============

An error occurred. Exiting...

[FemeniasM]

Hi @DanielaMombach, it looks like you are using an older version of bedtools. It should work with version 2.29.1 or later. Simply update the current version of the program. Cheers

[DanielaMombach]

Thank you! I've updated bedtools, but now another error appeared.

bash /home/dani/software/ExplorATE_shell_script/ExplorATE mo -p8 -b /mnt/d/bedtools.static.binary -s /usr/bin/salmon -f hg38.p13.fa -g hg38.refGene.gtf -r hg38.p13.fa.out -e pe -l reads/ -o out_mo                                                            =============================
|||       ExplorATE       |||
=============================
-p <threads> = 8
-b <bedtools binary> = /mnt/d/bedtools.static.binary
-s <salmon path> = /usr/bin/salmon
-f <fasta genome> = /mnt/d/explorate/hg38.p13.fa
-g <gtf genome> = /mnt/d/explorate/hg38.refGene.gtf
-r <RepeatMasker file> = /mnt/d/explorate/hg38.p13.fa.out
-e <libraries format 'pe' | 'se'> = pe
-l <fastq libraries path> = /mnt/d/explorate/reads
-o <Output files Path> = /mnt/d/explorate/out_mo

Making TEs references
=====================
---------------------------
Genomic features processing
---------------------------
[2022-08-26 11:40:58][INFO] recording chromosome lengths...
[2022-08-26 11:42:51][INFO] Extracting introns, UTRs and intergenic regions

------------------------------------
Searching TE targets based in genome
------------------------------------
[2022-08-26 11:44:02][INFO] 269529 intergenic.bed intergenic regions found
[2022-08-26 11:44:02][INFO] Extracting repeats from intergenic regions
[2022-08-26 11:45:50][INFO] intersecting intergenic regions
awk: cmd. line:1: BEGIN{while((getline<"RMref.txt")>0)} {print $1,$2,$3}
awk: cmd. line:1:                                     ^ syntax error

===============
/// ABORTED ///
===============

An error occurred. Exiting...

[FemeniasM]

This bug is fixed in the current version of the program. Update the scripts in the ExplorATE_shell_script/bin folder. Please let me know if this works for you now.

[DanielaMombach]

Thank you again! I was able to get pass that error, however another one appeared. I was wondering if you knew how to fix it. I've also tried another server and after "line 297:" says "segmentation fail" instead of "killed", both the same error.

[2022-08-27 08:47:18.599] [puff::index::jointLog] [info] Clipped poly-A tails from 158,433 transcripts
/home/dani/software/ExplorATE_shell_script/bin/ExplorATE_mo.sh: line 297: 24138 Killed                  $salmon_path index -p $threads -t trmeSalmon.fa -k $kmer -i SALMON_INDEX --decoys decoys.txt

===============
/// ABORTED ///
===============

An error occurred. Exiting...

[FemeniasM]

Thank you for sharing this issue. Is it possible that you are using an older version of Salmon? ExplorATE uses the Selective Alignment that is included in current versions of Salmon. If you use an older version of the program, the argument --decoys would not be recognized. Make sure you are using a current version of salmon (e.g., version 1.4.0 is suggested in the program requirements). If the version is correct, and the problem still persists, please send me a header of the files trmeSalmon.fa and decoys.txt.

[DanielaMombach]

I'm using salmon version 1.9.0 in a conda environment (everything is up to date). I'm sending you the headers.

labdros@bioinfo:/media/labdros/Elements/Daniela/out_mo/temp$ head decoys.txt
d_chr11187312227
d_chr11261212721
d_chr11322014829
d_chr11496915038
d_chr11579515947
d_chr11660616765
d_chr11685717055
d_chr11723217436
d_chr11760517742
d_chr11791418061
labdros@bioinfo:/media/labdros/Elements/Daniela/out_mo/temp$ head trmeSalmon.fa
>chr11150511675
agactcctaaatatgggattcctgggtttaaaagtaaaaaataaatatgtttaatttgtg
aactgattaccatcagaattgtactgttctgtatcccaccagcaatgtctaggaatgcct
gtttctccacaaagtgtttacttttggatttttgccagtctaacaggtga
>chr11167811780
cctggagattcttattagtgatttgggctggggcctggccatgtgtatttttttaaattt
ccactgatgattttgctgcatggccggtgttgagaatgactg
>chr11526515355
cactgtacaatggggaaactggcccagagaggtgaggcagcttgcctggggtcacagagc
aaggcaaaagcagcgctgggtacaagctca

[FemeniasM]

The headers of these files look fine. I've replicated your run using Salmon version 1.9, and the references available here, and the program finished successfully. There seems to be a problem with Salmon on your server. Using the paths provided above, you can verify this by runs: /usr/bin/salmon index -p 8 -t /media/labdros/Elements/Daniela/out_mo/temp/trmeSalmon.fa -i SALMON_INDEX --decoys /media/labdros/Elements/Daniela/out_mo/temp/decoys.txt

Salmon's segmentation fail were observed in runs with salmon installed from bioconda with other versions of the program. Maybe installing Salmon from precompiled files might work for you.