"Sense" or "Antisense"

[jjbruckner]

Hi, Can you help me understand how to choose the correct input for the prompt that says:

"is the guide in the same strand as the 'sense' primer or 'antisense' primer?"

By guide, do you mean the sequence of the guide or the sequence that guide binds? And when you refer to the primer, do you mean the strand that is elongated off that primer, or the strand that primer binds?

Thanks for your help,

Joseph Bruckner

[GTPowell21]

Hi Joseph,

I mean the sequence of the guide and the strand that is elongated off that primer. For example, I would say the {guide+PAM} is on the same strand as the antisense [primer] in the following example:

S: [CTGGTCCAGTGCGTTATTGG]TGA-//-AATCCGGGTGCAGGTACGTCCTGTAGGGC-//-GAGAAAAGAGCAAGAAGCATTTGGCT AS: GACCAGGTCACGCAATAACCACT-//-TTA{GGCCCACGTCCATGCAGGACATC}CCG-//-CTC[TTTTCTCGTTCTTCGTAAACCGA]

I specify orientation so that the script can design tags that have a 3' end spanning the predicted cut site.

Yours,

Gareth

[jjbruckner]

Thank you for the quick response Gareth, I think that makes sense. So then when I input the sequence for the guide plus 15 bp downstream, that should be downstream of the PAM, correct? And in 5'-3' orientation for guides on the antisense strand like in your example?

And another question - how do you interpret a Headloop PCR result with a band in the uninjected control? I presume this means that the headloop tag wasn't efficiently binding (in both the uninjected and CRISPR-injected animals), but I'm unsure what I should change to troubleshoot it. Is the best way forward to just try the headloop tag on the other primer instead?

[GTPowell21]

Hi Joseph,

Yes, 15 bp forward of the PAM, written in the 5'-3' direction (so in the example above that would be {CTACAGGACGTACCTGCACCCGG}ATT...).

I agree with your interpretation, a band in the uninjected control would suggest that the headloop tag isn't working efficiently. That could be because of a mismatch between the annealing temperature of the primers and the tag (so I try to match them as best as possible) or variation in the target sequence - we think a SNP is enough to prevent suppression in some cases. I'd recommend testing the headloop tag on a few uninjected embryos, just to catch any possible background variation that might confound your assay. If the first tag doesn't seem to work well, then my first step would be to try the other. If neither work well then I would start to adjust the annealing temperature, though I haven't had that happen to me yet, thankfully.

Yours,

Gareth

[jjbruckner]

Thank you so much for the advice, I'll try some different primer configurations. And thank you and your whole group for developing this approach, it's working well in our hands so far!

[GTPowell21]

Great, I'm glad to hear its working well for you. The real credit should go to Rand et al for the ingenious idea (Nucleic Acids Res. 2005; 33(14): e127. doi: 10.1093/nar/gni120)!