search

Gaius-Augustus / BRAKER

BRAKER is a pipeline for fully automated prediction of protein coding gene structures with GeneMark-ES/ET/EP/ETP and AUGUSTUS in novel eukaryotic genomes
Other
348 stars 79 forks source link

ERROR: in file /opt/BRAKER/scripts/braker.pl at line 3614 Genome file /work/FAC/mod_GCA_030586385.1_ASM3058638v1_genomic.fa does not exist. #743

Open LliliansCalvo opened 8 months ago

LliliansCalvo commented 8 months ago

Trying to run braker for the first time and im getting this error:

singularity exec braker3.sif braker.pl –species=Cfellah --genome=/work/FAC/mod_GCA_030586385.1_ASM3058638v1_genomic.fa   --rnaseq_sets_ids=SRR24634932_1,SRR24634932_2   --rnaseq_sets_dirs=/scratch/lcalvogo/Braker/fastq

#**********************************************************************************
#                               BRAKER CONFIGURATION                               
#**********************************************************************************
# BRAKER CALL: /opt/BRAKER/scripts/braker.pl –species=Cfellah --genome=/work/FAC/FBM/CIG/mod_GCA_030586385.1_ASM3058638v1_genomic.fa --rnaseq_sets_ids=SRR24634932_1,SRR24634932_2 --rnaseq_sets_dirs=/scratch/lcalvogo/Braker/fastq
# Mon Jan 15 14:51:26 2024: braker.pl version 3.0.6
# Mon Jan 15 14:51:26 2024: Only RNA-Seq input detected, BRAKER will be executed in ET mode (BRAKER1).
# Mon Jan 15 14:51:26 2024: Configuring of BRAKER for using external tools...
# Mon Jan 15 14:51:26 2024: Searching for local files of RNA-Seq sets in /scratch/lcalvogo/Braker/fastq ...
# Mon Jan 15 14:51:26 2024: Couldn't find local RNA-Seq library for SRR24634932_1, will try to download it from SRA later.
# Mon Jan 15 14:51:26 2024: Couldn't find local RNA-Seq library for SRR24634932_2, will try to download it from SRA later.
# Mon Jan 15 14:51:26 2024: Trying to set $AUGUSTUS_CONFIG_PATH...
# Mon Jan 15 14:51:26 2024: Found environment variable $AUGUSTUS_CONFIG_PATH.
# Mon Jan 15 14:51:26 2024: Checking /usr/share/augustus/config/ as potential path for $AUGUSTUS_CONFIG_PATH.
# Mon Jan 15 14:51:26 2024: Success! Setting $AUGUSTUS_CONFIG_PATH to /usr/share/augustus/config/!
# Mon Jan 15 14:51:26 2024: WARNING: in file /opt/BRAKER/scripts/braker.pl at line 1894
AUGUSTUS_CONFIG_PATH/species (in this case /usr/share/augustus/config//species) is not writeable. BRAKER will try to copy the AUGUSTUS config directory to a writeable location.
#**********************************************************************************
#                               BRAKER CONFIGURATION                               
#**********************************************************************************
# BRAKER CALL: /opt/BRAKER/scripts/braker.pl –species=Cfellah --genome=/work/FAC/FBM/CIG/mod_GCA_030586385.1_ASM3058638v1_genomic.fa --rnaseq_sets_ids=SRR24634932_1,SRR24634932_2 --rnaseq_sets_dirs=/scratch/lcalvogo/Braker/fastq
# Mon Jan 15 14:51:26 2024: braker.pl version 3.0.6
# Mon Jan 15 14:51:26 2024: Only RNA-Seq input detected, BRAKER will be executed in ET mode (BRAKER1).
# Mon Jan 15 14:51:26 2024: Configuring of BRAKER for using external tools...
# Mon Jan 15 14:51:26 2024: Searching for local files of RNA-Seq sets in /scratch/lcalvogo/Braker/fastq ...
# Mon Jan 15 14:51:26 2024: Couldn't find local RNA-Seq library for SRR24634932_1, will try to download it from SRA later.
# Mon Jan 15 14:51:26 2024: Couldn't find local RNA-Seq library for SRR24634932_2, will try to download it from SRA later.
# Mon Jan 15 14:51:26 2024: Trying to set $AUGUSTUS_CONFIG_PATH...
# Mon Jan 15 14:51:26 2024: Found environment variable $AUGUSTUS_CONFIG_PATH.
# Mon Jan 15 14:51:26 2024: Checking /usr/share/augustus/config/ as potential path for $AUGUSTUS_CONFIG_PATH.
# Mon Jan 15 14:51:26 2024: Success! Setting $AUGUSTUS_CONFIG_PATH to /usr/share/augustus/config/!
# Mon Jan 15 14:51:26 2024: WARNING: in file /opt/BRAKER/scripts/braker.pl at line 1894
AUGUSTUS_CONFIG_PATH/species (in this case /usr/share/augustus/config//species) is not writeable. BRAKER will try to copy the AUGUSTUS config directory to a writeable location.
# Mon Jan 15 14:51:26 2024: Trying to set $AUGUSTUS_BIN_PATH...
# Mon Jan 15 14:51:26 2024: Found environment variable $AUGUSTUS_BIN_PATH.
# Mon Jan 15 14:51:26 2024: Checking /usr/bin/ as potential path for $AUGUSTUS_BIN_PATH.
# Mon Jan 15 14:51:26 2024: Success! Setting $AUGUSTUS_BIN_PATH to /usr/bin/!
# Mon Jan 15 14:51:26 2024: Trying to set $AUGUSTUS_SCRIPTS_PATH...
# Mon Jan 15 14:51:26 2024: Found environment variable $AUGUSTUS_SCRIPTS_PATH.
# Mon Jan 15 14:51:26 2024: Checking /usr/share/augustus/scripts/ as potential path for $AUGUSTUS_SCRIPTS_PATH.
# Mon Jan 15 14:51:26 2024: Success! Setting $AUGUSTUS_SCRIPTS_PATH to /usr/share/augustus/scripts/!
# Mon Jan 15 14:51:26 2024: WARNING: BRAKER will copy the
 AUGUSTUS_CONFIG folder into your home directory!
# Mon Jan 15 14:51:26 2024: WARNING: $AUGUSTUS_CONFIG_PATH/species (in this case /usr/share/augustus/config//species ) is not writeable.
*** IMPORTANT: Resetting $AUGUSTUS_CONFIG_PATH=/users/lcalvogo/.augustus because BRAKER requires a writable location!
# Mon Jan 15 14:51:26 2024: Trying to set $PYTHON3_PATH...
# Mon Jan 15 14:51:26 2024: Did not find environment variable $PYTHON3_PATH.
# Mon Jan 15 14:51:26 2024: Trying to guess PYTHON3_PATH from location of python3 executable that is available in your $PATH
# Mon Jan 15 14:51:26 2024: Checking /opt/conda/bin as potential path for $PYTHON3_PATH.
# Mon Jan 15 14:51:26 2024: Success! Setting $PYTHON3_PATH to /opt/conda/bin!
# Mon Jan 15 14:51:26 2024: Trying to set $GENEMARK_PATH...
# Mon Jan 15 14:51:26 2024: Found environment variable $GENEMARK_PATH.
# Mon Jan 15 14:51:26 2024: Checking /opt/ETP/bin as potential path for $GENEMARK_PATH.
#*********
# WARNING: Couldn't find gmes_petap.pl in /opt/ETP/bin. Will not set $GENEMARK_PATH to /opt/ETP/bin!
#*********
# Mon Jan 15 14:51:26 2024: Trying to guess GENEMARK_PATH from location of gmes_petap.pl executable that is available in your $PATH
# Mon Jan 15 14:51:26 2024: Checking /opt/ETP/bin/gmes as potential path for $GENEMARK_PATH.
# Mon Jan 15 14:51:26 2024: Success! Setting $GENEMARK_PATH to /opt/ETP/bin/gmes!
# Mon Jan 15 14:51:26 2024: Trying to set $SRATOOLS_PATH...
# Mon Jan 15 14:51:26 2024: Did not find environment variable $SRATOOLS_PATH.
# Mon Jan 15 14:51:26 2024: Trying to guess SRATOOLS_PATH from location of fastq-dump executable that is available in your $PATH
# Mon Jan 15 14:51:26 2024: Checking /opt/ETP/tools as potential path for $SRATOOLS_PATH.
# Mon Jan 15 14:51:26 2024: Success! Setting $SRATOOLS_PATH to /opt/ETP/tools!
# Mon Jan 15 14:51:26 2024: Trying to set $HISAT2_PATH...
# Mon Jan 15 14:51:26 2024: Did not find environment variable $HISAT2_PATH.
# Mon Jan 15 14:51:26 2024: Trying to guess HISAT2_PATH from location of hisat2 executable that is available in your $PATH
# Mon Jan 15 14:51:26 2024: Checking /opt/ETP/tools as potential path for $HISAT2_PATH.
# Mon Jan 15 14:51:26 2024: Success! Setting $HISAT2_PATH to /opt/ETP/tools!
# Mon Jan 15 14:51:26 2024: Trying to set $BAMTOOLS_PATH...
# Mon Jan 15 14:51:26 2024: Did not find environment variable $BAMTOOLS_PATH.
# Mon Jan 15 14:51:26 2024: Trying to guess BAMTOOLS_PATH from location of bamtools executable that is available in your $PATH
# Mon Jan 15 14:51:26 2024: Checking /usr/bin as potential path for $BAMTOOLS_PATH.
# Mon Jan 15 14:51:26 2024: Success! Setting $BAMTOOLS_PATH to /usr/bin!
# Mon Jan 15 14:51:26 2024: Trying to set $SAMTOOLS_PATH...
# Mon Jan 15 14:51:26 2024: Did not find environment variable $SAMTOOLS_PATH.
# Mon Jan 15 14:51:26 2024: Trying to guess SAMTOOLS_PATH from location of samtools executable that is available in your $PATH
# Mon Jan 15 14:51:26 2024: Checking /usr/bin as potential path for $SAMTOOLS_PATH.
# Mon Jan 15 14:51:26 2024: Success! Setting $SAMTOOLS_PATH to /usr/bin!
# Mon Jan 15 14:51:26 2024: Trying to set $DIAMOND_PATH...
# Mon Jan 15 14:51:26 2024: Did not find environment variable $DIAMOND_PATH.
# Mon Jan 15 14:51:26 2024: Trying to guess DIAMOND_PATH from location of diamond executable that is available in your $PATH
# Mon Jan 15 14:51:26 2024: Checking /opt/ETP/tools as potential path for $DIAMOND_PATH.
# Mon Jan 15 14:51:26 2024: Success! Setting $DIAMOND_PATH to /opt/ETP/tools!
# Mon Jan 15 14:51:26 2024: Trying to set $TSEBRA_PATH...
# Mon Jan 15 14:51:26 2024: Did not find environment variable $TSEBRA_PATH.
# Mon Jan 15 14:51:26 2024: Trying to guess TSEBRA_PATH from location of tsebra.py executable that is available in your $PATH
# Mon Jan 15 14:51:26 2024: Checking /opt/TSEBRA/bin as potential path for $TSEBRA_PATH.
# Mon Jan 15 14:51:26 2024: Success! Setting $TSEBRA_PATH to /opt/TSEBRA/bin!
# Mon Jan 15 14:51:26 2024: Trying to set $CDBTOOLS_PATH...
# Mon Jan 15 14:51:26 2024: Did not find environment variable $CDBTOOLS_PATH.
# Mon Jan 15 14:51:26 2024: Trying to guess CDBTOOLS_PATH from location of cdbfasta executable that is available in your $PATH
# Mon Jan 15 14:51:26 2024: Checking /opt/cdbfasta as potential path for $CDBTOOLS_PATH.
# Mon Jan 15 14:51:26 2024: Success! Setting $CDBTOOLS_PATH to /opt/cdbfasta!
#*********
# IMPORTANT INFORMATION: no species for identifying the AUGUSTUS  parameter set that will arise from this BRAKER run was set. BRAKER will create an AUGUSTUS parameter set with name Sp_3. This parameter set can be used for future BRAKER/AUGUSTUS prediction runs for the same species. It is usually not necessary to retrain AUGUSTUS with novel extrinsic data if a high quality parameter set already exists.
#*********
# Mon Jan 15 14:51:26 2024: ERROR: in file /opt/BRAKER/scripts/braker.pl at line 3614
Genome file /work/FAC/mod_GCA_030586385.1_ASM3058638v1_genomic.fa does not exist.

Except that the genome file does exist:

head /work/FAC/mod_GCA_030586385.1_ASM3058638v1_genomic.fa
>JAPIVC010000001.1
GCGTTATGCAACAccttctattattaaaaatctcggCCCCCATATATTGGTTTTAACTTGTGTATTGAAATTGCAAGTCG
AGGATGCTCATTGAAACCTTGACATTGAGGACCTTGACATTCttacgagaaaattaaaagaaaataagataagAAGACAG
TGAAAAATGATAAGTCGGATAGACGTCTAAGACGTCTAgacgtttaataaatatctagacATCTATTAAACATCTTAGAC
GTCTATTCGACTTATCATTTCTTACTGTGGAGTTATCAGAAAAAACGAAACATATAACTAACACATTTCTATCAATAAAA
CATGACATAATTTGCGAATTCTATAACctaactaatttttttctattgcatCAAACGATTATGATTCTTTTTGGTCAAAC
TTCTTGCGGATTATTTAGTTCAAGAAATTTgggaaattgattaaaaattattcatgtctCTGCGCtgattaattcatatt
KatharinaHoff commented 7 months ago

You did not mount the directory where the genome file sits. You find an example of mounting $PWD in our instructions. If the file is not in $PWD, you need to mount a different location.