search

Gaius-Augustus / BRAKER

BRAKER is a pipeline for fully automated prediction of protein coding gene structures with GeneMark-ES/ET/EP/ETP and AUGUSTUS in novel eukaryotic genomes
Other
365 stars 81 forks source link

503: SyntaxWarning: invalid escape sequence '\.' #884

Open Georicl opened 1 week ago

Georicl commented 1 week ago

When I use braker an error has been encountered.\ open errors/GeneMark-ET.stderr\

/ME4012_Vol0002/Ahome_Dir/waiyong/genome_build/Genemark/gmetp_linux_64/bin/gmes/ProtHint/bin/prothint.py:503: SyntaxWarning: invalid escape sequence '\.'
  systemCall('sed \"s/\.//\" ' + args.proteins + ' | sed \"s/|/_/g\" > ' +

so I open prothint.py\ line 503 systemCall('sed \"s/\.//\" ' + args.proteins + ' | sed \"s/|/_/g\" > ' +\ But when I rewrote it as systemCall('sed \"s/\\.//\" ' + args.proteins + ' | sed \"s/|/_/g\" > ' +\ or systemCall(r'sed \"s/\.//\" ' + args.proteins + ' | sed \"s/|/_/g\" > ' +\ It fails to run them all and shows no display at error and shows termination at the same place in GeneMark-ET.stdout\

# check before the run
# hard_mask is in the 'auto' mode. hard_mask was set to: 100
# creat directories
# commit input data
# prepare input data report
# commit training data
error, input sequence size is too small data/training.fna: 50000

The species I'm studying is oryzias curvinotus.Can you answer my current difficulties, thank you very much! env： Python 3.12.7 braker2 3.0.8 geneMark-ETP

xo2003 commented 1 week ago

@Georicl I encountered this issue before. In my experience, Python 3.12 caused the problem, so you should try downgrading to Python 3.11 or lower. I set my Python version to 3.11.9, and the error disappeared.

Georicl commented 1 week ago

thank u gays!I'm going to try this way, I searched before for a possible error reporting bug in python 3.12.*, but this was supposedly waring in the previous version, just changed to error in this same one, I thought it was all stopping the process itself because of the error. @xo2003

Georicl commented 1 week ago

Now I'm having a classic problem with my GeneMark reporting an error error, input sequence size is too small data/training.fna: 50000 so I watch ./GeneMark-ET/data/dna.fna

1_dna XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX it became like this! but my input fasta like this: HiC_scaffold_1 cagtccatcaagcatctggtctctggggggggaacctcacagatggacgcagtacggaatccccatgggtggcaggaact gtcaccacaggaggtcgatcctagagctttgttcttcacacgtgaacggacgcctggagggttcccacagctacagtacc agagatagttaatttatggcccatgtcagacctgcaaccaaatggccttagaagatcaaagacggtttctcctgaagggg gatgagattgaagctgcattcctgaaacctctcacatatgcaactaaggaagcttctttaaagtacataggatgttaaaa cacacacacttcagcaaatgacttatcttctatgtaataaaatttaagactgacaaccctaatgaaattaccaaaaacat aaattccttcagttccctgtcttgacctcatgaagtgaggtcacacaaaaacacatactacatcatacaatgactaaaca tttcagcaggtccagctgtggtcgtaagccctcacattctgcagcacaatcaataactgggatttttaaacggggtggat gatttatgcaatgagtctagaatcaaattaagagaatacaaagatgtaaattcgaaataaaacataaaaatgcaaattaa aattatttaaaaagtaaaaatataaagacaataaaaataacgcttcctgtaagaaaaagaacacctagaattaagggaga aatggggagatgttaggacaaaacaaaatcacacaggggacaaaagaaaaatagaattgtcaaacactggccaaataaga atagcaatattctgttaatattagttagttagttggttagtatattaaatattgcaacaaaatccaaaatcattcagggc tttgaccactcacgtcctcctgcatgtcccacaagctctggcaagcttggacttggccccctatggacttttcaataagc ctggtaattaaagatctgacacatgtgatacaacagaacacaaagacaaaaaacaatgagacaagaataaaattacgcat gcgcagaagaggagcaatatgtggtggaaaatgtccaccacgttttcctctccaaggtctgcttctcctcatgctgtttt How do I fix this error? My input command is：

nohup perl braker/BRAKER-3.0.8/scripts/braker.pl --species=zj --genome=/ptah/to/genome.nextpolish.FINAL_rm29.fasta --bam=/path/to/1.bam --threads=20  &