log of commands

[EmeTexe]

Hello,

Thank you for the tool.

I wanted to know if there is any log where I can check which commands where launched by XICRA, and the exact parameters used for the command? I checked the logs generated by test_subset.sh, but only found some of the commands used (mainly multiqc).

Thanks for your time, Emeric

[JFsanchezherrero]

Hi there Emeric, Thanks for trying XICRA.

You should have a new folder generated where you executed the test_subset.sh file named as logs/ containing several files with logs and errors for each step.

Also, if you check the filetest_subset.shthese are the XICRA commands executed, as an example for the singe-end reads provided.

## prepare reads, folders and subfolders
XICRA prep -i ./subset_SE/ -o XICRA_analysis --single_end | tee logs/XICRA_analysis.prep.log

## Quality check
XICRA QC -i XICRA_analysis --single_end --threads 4 | tee logs/XICRA_analysis.qc.log

## trim any adapters
XICRA trim -i XICRA_analysis --single_end --threads 4 --adapters_a TGGAATTCTCGGGTGCCAAGG | tee logs/XICRA_analysis.trim.log

## create miRNA analysis
XICRA miRNA -i XICRA_analysis --single_end --threads 4 --software miraligner | tee logs/XICRA_analysis.miRNA.log

Take into account that the | tee whatever_file.log allows us to see the output in screen and print it in a file. Check these files for additional details.

I hope I have answered your questions. Do not hesitate to contact us again. Best regards

[EmeTexe]

Hi,

Thanks for your answer!

What I want to know is the commands launched by XICRA. What are the parameters used for STAR, cutadapt, miRTop... I couldn't find this information in any of the log files.

Best regards,

Emeric

[JFsanchezherrero]

Hi there Emeric,

I think you should be able to find this information in the logs file mentioned.

I would say that every single time we call the system to call any third party software, we use the same code that creates these type of messages coloured coded:

So you can track all the parameters and options applied, full absolute paths etc

Please take a look an let me know if not. Did it work succesfully? Has the counts file been generated in folder report/miRNA?

Best regards

[EmeTexe]

Hi,

Seems like my logs had a problem, I reran the test_subset.sh after cleaning the outputs, and now have the commands with their parameters in the logs.

Thank you for your time, Best regards

Emeric

[JFsanchezherrero]

Great! Do not hesitate to contact us again.

Best regards

[EmeTexe]

Hi, I have another question. In the XICRA_analysis_PE.miRNA.log file, there is this file XICRA_test_dir/XICRA_analysis_PE/data/rep_1/miRNA/miraligner/rep_1-tab.freq.txt which is used as input for miraligner, but there is nowhere in the logs that says how it was generated. How is it generated, and what exactly is inside?

best regards, Emeric

[JFsanchezherrero]

Hi there Emeric, The step that you mention is a preprocessing of the reads to create a frequency table to input into miraligner. This process is coded within the XICRA script here: https://github.com/HCGB-IGTP/XICRA/blob/6e9b4121f27cd60bb5640934eab16bd27c572395/XICRA_pip/XICRA/scripts/miraligner_caller.py#L85-L86

where we basically called this function reads2tabular to create a dictionary from the reads with information of the frequency of each sequence identified.

The reads2tabular function is included in a secondary python package (HCGB) that we also develop. See details here

Best regards,

[EmeTexe]

Hi,

Thank you for your answer! It says on the miraligner documentation that it can take fastq files as input, why did you chose to use a frequency table instead of simply the fastq from fastq-join?

Best regards, Emeric

[JFsanchezherrero]

Hi Emeric, I can not remember right now (several years ago) but I have the feeling there was an issue when using the fastq option that prevent us from using as a default.

We basically converted the fastq-join (or single-end fastq file) into this frequency table to use it as an input into miraligner.

Best regards