InputFunctionException in line 5 /rules/map.smk

[olechnwin]

Hi,

I cannot figure out how to fix this error:

InputFunctionException in line 5 of /rules/map.smk: KeyError: 'the label [sample1_N706_S2_L001_MOUSE] is not in the [index]' Wildcards: sample=sample1_N706_S2_L001_MOUSE

I've ran snakemake --cores 12 qc filter map and it ran to completion. Then, the above error happen when running: snakemake --cores 12 split_species extract_species

here is my config.yaml: LOCAL: TMPDIR: ~/tmp DROPSEQ-wrapper: opt/Drop-seq_tools-1.13/drop-seq-tools-wrapper.sh MEMORY: 32g META: species:

• HUMAN
• MOUSE species_ratio: 0.20 reference_file: hg19_mm10_transgenes.fasta annotation_file: hg19_mm10_transgenes.gtf reference_folder: opt/dropSeqPipe/ref FILTER: IlluminaClip: NexteraPE-PE.fa 5PrimeSmartAdapter: GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAC Cell_barcode: start: 1 end: 12 min_quality: 30 num_below_quality: 0 UMI: start: 13 end: 20 min_quality: 30 num_below_quality: 0 EXTRACTION: bc_edit_distance: 0 min_count_per_umi: 1 STAR_PARAMETERS: outFilterMismatchNmax: 10 outFilterMismatchNoverLmax: 0.3 outFilterMismatchNoverReadLmax: 1 outFilterMatchNmin: 0

[Hoohm]

Hello @olechnwin This is a known bug and I'm working on it. I have a testing fix. Can you try to add those lines to the Snakefile file:

wildcard_constraints:
    sample="({})".format("|".join(samples.index))

Tell me if it works

[olechnwin]

Hi @Hoohm Where should I put those lines? under rule split_species?

update: looks like the above fix works when I put it below read_lengths line.

[Hoohm]

@olechnwin Great news!

This will be added in the next release. Can this issue be closed?