Open LJ-jiao opened 2 weeks ago
If you want to get the genotype involving both motifs, you can define the first motif as the repeated unit and the length of all 3 repeats as the region. Both motifs (3 repeats) will be counted despite the 1-nucleotide difference.
[
{
"LocusId": "FCGRT",
"LocusStructure": "(CGGACTCCTGGGTCCGAGGGTAGAGCGGTTGGGGGCC)*",
"ReferenceRegion": "chr19:49512985-49513096",
"VariantId": "FCGRT",
"VariantType": "Repeat"
}
]
I want to create a
variant_catalog.json
file to identify VNTR in FcRn gene using WGS sequencing data. The FcRn gene contains a VNTR sequence consisting of three repeats of 37 nucleotides each, with one nucleotide difference in the third repeat compared to the first two repeats. How should I write this JSON file?The sequence of this region is as follows.