search

Illumina / Nirvana

The nimble & robust variant annotator
https://illumina.github.io/NirvanaDocumentation/
GNU General Public License v3.0
171 stars 44 forks source link

Mismatch global Minor Allele Frequency #33

Closed SamGLZ closed 4 years ago

SamGLZ commented 4 years ago

Hi all, I found a result of the global Minor Allele Frequency result which may be a mismatch when I annotated an indel variant with Nirvana. The returned result belongs to the next base. What I can do to make it right?

The variant I annotated: GRCh37: 1:46736380 T>TCGAGACGCTGCTGCTAGTGAGGCAGACAGGCAGCTAGGAGAGGAGCGGCTGCGGGAGCTCACCAGCATTGTGAATAGGTAATGACCTTAAGC

The result of globalMinorAlleleFrequency is 0.0001997, which belongs to 1:46736381-T (ref: C). And 1:46736380 has no global Minor Allele Frequency and no record in 1000 Genome Project.

Thank you!

rajatshuvro commented 4 years ago

Hi Sam, Nirvana trims common bases from ref and alt allele (e.g. padding bases) and left shifts the variants in order to ensure proper matching across different equivalent representations. As a result, for the insertions you cited, the position is incremented by 1 and the global minor frequency for 1:46736381 is reported. This is according to our design.

However, while calculating GMAF, we only considered SNVs. So, you can disregard it for anything other than SNVs.

Hope that helps Rajat