search

Illumina / isaac2

Aligner for sequencing data
Other
21 stars 4 forks source link

Improper CIGARs #15

Closed mjafin closed 8 years ago

mjafin commented 8 years ago

Hi there, We've come across several improper CIGAR strings produced by isaac and have as a temporary measure addressed them in our variant caller. Could you take a look when you have the time please. Ticket with example data available here: https://github.com/AstraZeneca-NGS/VarDictJava/issues/37#issuecomment-247366021

rpetrovski commented 8 years ago

The example data seems to have been built with iSAAC-01. Both iSAAC-01 and iSAAC-02 are not being supported anymore. Please let me know if the issue still exists with iSAAC-03

Roman.

$ samtools view bam/problem.bam -H |grep VN @HD VN:1.0 SO:coordinate @PG ID:iSAAC PN:iSAAC CL:/opt/illumina/Isis/2.5.26.13/Workflows/ResequencingWorker/isaac-align -t /home/ec2-user/compute/scratch/isaacTemp -o /home/ec2-user/compute/344404/isaac_align/Alignment -r /opt/genomes/Homosapiens/UCSC/hg38-hli/Sequence/IsaacIndex/sorted-reference.xml --base-calls HLVMVCCXX -s HLVMVCCXX/SampleSheetNew.csv --ignore-missing-filters 1 --base-quality-cutoff 15 --use-bases-mask Y150N1,Y150N1 --default-adapters AGATCGGAAGAGCACACGTCTGAACTCCAGTCA,_TGACTGGAGTTCAGACGTGTGCTCTTCCGATCT --variable-read-length yes --barcode-mismatches 1 --ignore-missing-bcls 1 --stop-at Finish --allow-empty-flowcell 1 --seed-length 32 --cleanup-intermediary 1 --verbosity 3 --start-from Start --lane-number-max 8 --memory-limit 56 --base-calls-format fastq-gz --stats-image-format none --per-tile-tls 1 VN:iSAAC-01.14.02.06