search

Immunotools / IgDetective

a tool for annotation of immunoglobulin genes in genome assemblies
GNU General Public License v3.0
10 stars 1 forks source link

Identical IGH_D gene features on opposite strands #9

Open vkkodali opened 1 year ago

vkkodali commented 1 year ago

I ran IgDetective on the entire mouse genome with default options as follows: 

python run_iterative_igdetective.py GCF_000001635.27_GRCm39_genomic.fna mouse_igdetective

I see the following features in the output file combined_genes_IGH.txt: 

D  NC_000078.7  113411833  +  GTAGCCTGAGCTGTCT          NA  IGH
D  NC_000078.7  113411833  -  AGACAGCTCAGGCTAC          NA  IGH
D  NC_000078.7  113414470  +  GTAGTTACCATAGTAGA         NA  IGH
D  NC_000078.7  113414470  -  TCTACTATGGTAACTAC         NA  IGH
D  NC_000078.7  113420339  +  GTCGTAACCATAGTAGA         NA  IGH
D  NC_000078.7  113420339  -  TCTACTATGGTTACGAC         NA  IGH
D  NC_000078.7  113424988  +  GTAGTTACTATAGTAGG         NA  IGH
D  NC_000078.7  113424988  -  CCTACTATAGTAACTAC         NA  IGH
D  NC_000078.7  113429646  +  GTAGTTACTATAGTAGG         NA  IGH
D  NC_000078.7  113429646  -  CCTACTATAGTAACTAC         NA  IGH
D  NC_000078.7  113434313  +  GTCGTAATCATAGTAGA         NA  IGH
D  NC_000078.7  113434313  -  TCTACTATGATTACGAC         NA  IGH
D  NC_000078.7  113439019  +  GTAGTAACCATCATAGA         NA  IGH
D  NC_000078.7  113439019  -  TCTATGATGGTTACTAC         NA  IGH
D  NC_000078.7  113445789  +  GTAGCTACTACCGTAGTAATAAA   NA  IGH
D  NC_000078.7  113445789  -  TTTATTACTACGGTAGTAGCTAC   NA  IGH
D  NC_000078.7  113488932  +  GTAGCCCGAGCTGTGCC         NA  IGH
D  NC_000078.7  113488932  -  GGCACAGCTCGGGCTAC         NA  IGH

These are otherwise identical features on opposite strands. Why are such features returned?