denovo_map.pl: Aborted because the last command failed (Error: Unable to load data)

[JavierUrban]

My problem is that I can't finish running denovo_map.pl.

I am using stacks on my local computer from a docker container with the following script stacks.denovo_map.prueba.sh

denovomap.pl is a program that is used to construct loci and to call SNPs de novo, this is used when there is no reference genome.

I want to run denovo_map.pl to identify SNPs in 93 samples with 23 and 22 individuals from 4 populations, but before I wanted to perform a test with 3 individuals from each population but I could not finish the process for these samples the program starts to run, but when you with to continue the analysis of sample 2, the process stops and displays an aborted message: denovo_map.pl: Aborted because the last command failed (1); see log file.

I first ran process_radtags, this is a program that checks the raw data from illumina and demultiplexes the samples for quality and cutoff sites of the restriction enzymes

I run the command as follows:

stacks process_radtags -P -p ../stacks/isuue2/GBS_raw/ --interleaved \
-b ../stacks/isuue2/barcodes_copes_iss.tsv -o ../stacks/isuue2/process_map_res/ \
-c -q -r --index_index --renz_1 mspI --renz_2 nsiI

The following image is an example of the raw data format and this is the barcode file that I use.

The output of process_radtags generates 4 different files .1 and .2 which are used to rundenovo_map.pl

And then run denovo_map.pl:

stacks denovo_map.pl --samples ../stacks/isuue2/process_map_res/ \
--popmap ../stacks/isuue2/popmap_tarea_issue.tsv -o ../stacks/isuue2/denovo_map_re2 \
-M 3 -n 2 -m 3 -X "populations: -r 0.50 --min_maf 0.01 --genepop"

Here is the population map file i use

And the following happens, showing the following message: denovo_map.pl: Aborted because the last command failed (1); see log file.

I tried looking for the error, and saw that it could be due to my computer's memory, but I also ran it on a cluster, and got the same error, I also saw that it could probably be due to the ID of the samples, but I tried to change them and they still do not finish the process, and I'm still confused because I don't know if I'm using some command or parameter wrong

[abelardoacm]

Trying to check for permission problems, when ls -lh is run on the folder containing the input, it can be noticed that the files are very light ... so much so that some appear to be empty.

When running the head command with a random file, it turned out to be blank.

[bc-anaisabel]

Error appears to be in how the radtags are being processed? Appears to be using only single-end sequences? Reason for this is still unknown

[abelardoacm]

Your data does not seem to be a interleaved paired-end file. Here is an example of such files:

NGCTCCTAGGTCGGCATGATGGGGGAAGGAGAGCATGGGAAGAAATGAGAGAGTAGCAA
+
#8BCCGGGGGFEFECFGGGGGGGGG@;FFGGGEG@FF<EE<@FFC,CEGCCGGFF<FGF
@M10991:61:000000000-A7EML:1:1101:14011:1001 2:N:0:28
NGCTCCTAGGTCGGCATGACGCTAGCTACGATCGACTACGCTAGCATCGAGAGTAGCAA
+
#8BCCGGGGGFEFECFGGGGGGGGG@;FFGGGEG@FF<EE<@FFC,CEGCCGGFF<FGF
@M10991:61:000000000-A7EML:1:1201:15411:3101 1:N:0:28
NGCTCCTAGGTCGGCATGATGGGGGAAGGAGAGCATGGGAAGAAATGAGAGAGTAGCAA
+
#8BCCGGGGGFEFECFGGGGGGGGG@;FFGGGEG@FF<EE<@FFC,CEGCCGGFF<FGF
@M10991:61:000000000-A7EML:1:1201:15411:3101 2:N:0:28
CGCTAGCTACGACTCGACGACAGCGAACACGCGATCGATCGGAAATGAGAGAGTAGCAA
+
#8BCCGGGGGFEFECFGGGGGGGGG@;FFGGGEG@FF<EE<@FFC,CEGCCGGFF<FGF

This could be related either to a mistake during download or you could have filtered all (or at least the vast majority) of R2 reads in a quality filtering.

You could try treating your files as single end.