JunyueCaoLab / EasySci

Computational pipeline to process EasySci-RNA data.
MIT License
12 stars 1 forks source link

Matching between read names and cell names #3

Open ndrubins opened 1 week ago

ndrubins commented 1 week ago

Hi,

In reference to the "A Panoramic View of Cell Population Dynamics in Mammalian Aging" publication, I was trying to figure out how to map between the read names in the fastq files (e.g., GTACTGGTTGGGTCCGCATC,CTCGTCGG,A00815:550:HJ2TCDSX5:3:2430:11162:30217) and the cell names in the processed data deposited under the GSE247719 accession (with the format such as: 20230206_EXP100_03_AACCGATTGC_Plate_1_GCGTTGGAGC_ATCCATGACT).

I'd greatly appreciate your help.

Thanks