dot_bracket output length does not match sequence length

[palakpsheth]

Hello,

For the given sequence ATATCTAGGTAGATAGCTAAGTAAATAACTACGTACATACCTCTCGGTCGATCGCTCAGTCAATCACTCCGTCCATCCCGGGGAGGGCGGAAGGACGGCAGGCCGAGAGCGAAAGAACGACAGACCGCGCAAGCACGCCAGCCCAAAACAACCACACCCCTTTTGTTTATTTCTTGGTTGATTGCTTAGTTAATTACTTC, the output of dot_bracket function with temp=55, the resulting dot_bracket result: ........................................((.(((.((..((((((...........((((((.(((..........))).))))))........))))))..)).))).)) does not have the same length

[dodoflyy]

Same problem:

x = "ACGCTCACCGTGCCCAGTGAGCGA"
y = seqfold.fold(x, temp=65)
print(len(x) == len(seqfold.dot_bracket(y)))

Output:

False

[jjti]

Hey @palakpsheth and @GuoYu-Peng, I believe this bug should be fixed. It required changing the dot_bracket method to take the seq to get its full length

[palakpsheth]

Hey @palakpsheth and @GuoYu-Peng, I believe this bug should be fixed. It required changing the dot_bracket method to take the seq to get its full length

Awesome thank you