Closed ijhoskins closed 2 months ago
Forgot to mention I am running seqfold version 0.7.17
Hey @ijhoskins, thanks for reporting this! I just pushed a fix. This was because of an unfortunate bug seen when the outermost structure is a multibranch. I pushed a fix and made a new release (0.7.18). Eg of the new results:
$ seqfold ACAAGCAGGAGCCUAUAAAUCCCUGAGGGGGCUGCUGGGACAUCACAGAAGGUGAAAGUC --dot-bracket --sub-structures
ACAAGCAGGAGCCUAUAAAUCCCUGAGGGGGCUGCUGGGACAUCACAGAAGGUGAAAGUC
.....(((.((((.......(((...))))))).))...((.((((.....))))..)))
i j ddg description
5 59 1.8 BIFURCATION:3n/2h
6 35 -2.1 STACK:AG/UC
7 34 -2.4 STACK:GGA/CGU
9 32 -2.1 STACK:AG/UC
10 31 -3.4 STACK:GC/CG
11 30 -3.3 STACK:CC/GG
12 29 4.6 BULGE:8
20 28 -3.3 STACK:CC/GG
21 27 -3.3 STACK:CC/GG
22 26 5.4 HAIRPIN:CU/GA
39 58 -2.2 STACK:AC/UG
40 57 -1.2 INTERIOR_LOOP:2/3
42 54 -2.4 STACK:UC/AG
43 53 -2.1 STACK:CA/GU
44 52 -2.2 STACK:AC/UG
45 51 4.3 HAIRPIN:CA/GG
-13.9
I'm closing as fixed, but please let me know if you see any more issues. Thanks for reporting this!
Hello,
I'm not sure if this is necessarily a bug, but I was hoping to gain some clarity on why inf values would be returned for some RNA sequences. Note this is not the case if the sequence is converted to DNA.