LihuaJulieZhu
commented
1 year ago Hi Shubham,
Thanks for the inquiry!
Did you use two different gRNAs for two different GUIDEseq experiments?
· If yes, you can simply run GUIDEseqAnalysis twice using one of the following two gRNA files.
gRNAfile1.fa
HEK239_site4
GGCACTGCGGCTGGAGGTGG
gRNAfile2.fa
EMX1
GAGTCCGAGCAGAAGAAGAA
- If not, you can run the analysis step by step according to https://bioconductor.org/packages/release/bioc/vignettes/GUIDEseq/inst/doc/GUIDEseq.pdf.
- In step 4, you will run offTargetAnalysisOfPeakRegions twice with one gRNA file at a time.
Best, Julie
From: Shubham Verma @.> Date: Monday, October 24, 2022 at 5:49 AM To: LihuaJulieZhu/GUIDEseq @.> Cc: Zhu, Lihua (Julie) @.>, Mention @.> Subject: [LihuaJulieZhu/GUIDEseq] How to use GUIDEseqAnalysis function for multiple gRNAs. (Issue #4)
Hi @LihuaJulieZhuhttps://nam10.safelinks.protection.outlook.com/?url=https%3A%2F%2Fgithub.com%2FLihuaJulieZhu&data=05%7C01%7Cjulie.zhu%40umassmed.edu%7Cc161ed30d6a543db516308dab5a51a82%7Cee9155fe2da34378a6c44405faf57b2e%7C0%7C0%7C638022017970347317%7CUnknown%7CTWFpbGZsb3d8eyJWIjoiMC4wLjAwMDAiLCJQIjoiV2luMzIiLCJBTiI6Ik1haWwiLCJXVCI6Mn0%3D%7C3000%7C%7C%7C&sdata=pk9i1m%2FL0a2U7%2BLwngmEpCl7yC3u6gHGPqtVJPtwA%2F8%3D&reserved=0 , Hope you are doing good, I wants to know how to run Guideseqanalysis function for multiple gRNAs, In document it is return that the gRNA.file file containing one or more gRNAs in fasta format, So i created one fasta file which looks like:-
HEK239_site4
GGCACTGCGGCTGGAGGTGG
EMX1
GAGTCCGAGCAGAAGAAGAA
Now both gRNAs will have different PAM sequences GGG (HEK)and GAA (EMX1) how can i setup this in PAM argument in Guideseqanalysis function . Can you please help me to resolve this doubt for multiple gRNAs sequnces.
— Reply to this email directly, view it on GitHubhttps://nam10.safelinks.protection.outlook.com/?url=https%3A%2F%2Fgithub.com%2FLihuaJulieZhu%2FGUIDEseq%2Fissues%2F4&data=05%7C01%7Cjulie.zhu%40umassmed.edu%7Cc161ed30d6a543db516308dab5a51a82%7Cee9155fe2da34378a6c44405faf57b2e%7C0%7C0%7C638022017970347317%7CUnknown%7CTWFpbGZsb3d8eyJWIjoiMC4wLjAwMDAiLCJQIjoiV2luMzIiLCJBTiI6Ik1haWwiLCJXVCI6Mn0%3D%7C3000%7C%7C%7C&sdata=YQBlSiewQKfrAHg8mi17%2BNqPgapG8Rj%2F%2Fw%2FYrDLMEvI%3D&reserved=0, or unsubscribehttps://nam10.safelinks.protection.outlook.com/?url=https%3A%2F%2Fgithub.com%2Fnotifications%2Funsubscribe-auth%2FAHHFRVBNROC3Y4XHPLEBTSTWEZLUFANCNFSM6AAAAAARMZWN2M&data=05%7C01%7Cjulie.zhu%40umassmed.edu%7Cc161ed30d6a543db516308dab5a51a82%7Cee9155fe2da34378a6c44405faf57b2e%7C0%7C0%7C638022017970503974%7CUnknown%7CTWFpbGZsb3d8eyJWIjoiMC4wLjAwMDAiLCJQIjoiV2luMzIiLCJBTiI6Ik1haWwiLCJXVCI6Mn0%3D%7C3000%7C%7C%7C&sdata=VeKpNhDVNlvmQ8ZaqngSuWrjLon9xQIT41A2aayStLY%3D&reserved=0. You are receiving this because you were mentioned.Message ID: @.***>
Shubhamverma-bioinfo
Hi @LihuaJulieZhu , Hope you are doing good, I wants to know how to run Guideseqanalysis function for multiple gRNAs, In document it is return that the gRNA.file file containing one or more gRNAs in fasta format, So i created one fasta file which looks like:-
Now both gRNAs will have different PAM sequences GGG (HEK)and GAA (EMX1) how can i setup this in PAM argument in Guideseqanalysis function . Can you please help me to resolve this doubt for multiple gRNAs sequnces.