search

LuyiTian / FLAMES

Full-length transcriptome splicing and mutation analysis
GNU General Public License v3.0
73 stars 11 forks source link

Flanking sequence match #35

Open lingminhao opened 1 year ago

lingminhao commented 1 year ago

Can I know when flames match flanking sequence CTACACGACGCTCTTCCGATCT, do they allow matching with an edit distance or it has to be exact match?

ChangqingW commented 1 year ago

Allowing a maximum edit distance as specified for the <5.max edit distance> argument in match_cell_barcode. Both flanking sequence alignment and barcode matching allow up to <5.max edit distance>.

lingminhao commented 1 year ago

@ChangqingW , thanks for the reply ! Just for further confirmation, is max edit distance means max edit distance for both flanking sequence alignment and barcode matching or max edit distance for each ?

ChangqingW commented 1 year ago

I believe it is currently implemented as "for each"