search

MVesuviusC / primerTree

PrimerTree: Visually Assessing the Specificity and Informativeness of Primer Pairs
GNU General Public License v2.0
51 stars 16 forks source link

Control size of blast hits? #7

Closed MVesuviusC closed 9 years ago

MVesuviusC commented 10 years ago

In blasting a couple primer pairs, I seem to have issues with either very short or long blast hits. I have one primer set that gives me a hit 187116bp long, which messes up the alignment and subsequent tree. I have another primer that gives a blast hit of 1bp, and gives me an error message. it would be handy to have a way to screen out blast hits outside of provided size constraints. Examples are below:

BirdCOI<-search_primer_pair(name="BirdCOI","TTCTCCAACCACAAAGACATTGGCAC","ACGTGGGAGATAATTCCAAATCCTG") BLASTing 1 primer combinations Submitting Primer-BLAST query BLAST alignment processing, refreshing in 20 seconds... BLAST alignment processing, refreshing in 20 seconds... BLAST alignment processing, refreshing in 20 seconds... BLAST alignment processing, refreshing in 20 seconds... BLAST alignment processing, refreshing in 20 seconds... BLAST alignment completed in 111 seconds 500 BLAST alignments parsed in 4 seconds taxonomy retrieved in 16 seconds Error in from:to : result would be too long a vector In addition: Warning messages: 1: In max(i) : no non-missing arguments to max; returning -Inf 2: In max(i) : no non-missing arguments to max; returning -Inf 500 sequences retrieved from NCBI in 413 seconds, product length min:1 mean:744.44 max:747 Error in file(con, "rb") : cannot open the connection In addition: Warning message: In file(con, "rb") : cannot open file '/tmp/Rtmpmfnkrk/file29136e363cca.aln': No such file or directory

trnH<-search_primer_pair(name="trnH","GTTATGCATGAACGTAATGCTC","CGCGCATGGTGGATTCACAATCC") BLASTing 1 primer combinations Submitting Primer-BLAST query BLAST alignment processing, refreshing in 20 seconds... BLAST alignment processing, refreshing in 20 seconds... BLAST alignment processing, refreshing in 20 seconds... BLAST alignment completed in 70 seconds 500 BLAST alignments parsed in 4 seconds taxonomy retrieved in 15 seconds 500 sequences retrieved from NCBI in 101 seconds, product length min:179 mean:821.29 max:187116 500 sequences aligned in 518 seconds length:188595 constructed neighbor joining tree in 2639 seconds Warning message: In fun(libname, pkgname) : couldn't connect to display ":0"

MVesuviusC commented 10 years ago

So after digging around and pawing through the code, it looks like one issue is that sometimes the program grabs the entire sequence of the gi hit instead of just the matching sequence. So that's one reason why we're seeing sequences ~180kbp long.

jimhester commented 10 years ago

I am not getting the errors you are getting here, are you using the code from github or from CRAN? Just run the below to be sure you are using the most recent version.

library(devtools)
install_packages("jimhester/primerTree")
library(primerTree)

I don't think I ever did an update for CRAN from the last bug you had, so it may still be that problem.

test = search_primer_pair(name="BirdCOI","TTCTCCAACCACAAAGACATTGGCAC","ACGTGGGAGATAATTCCAAATCCTG")
#  BLASTing 1 primer combinations
#  Submitting Primer-BLAST query
#  BLAST alignment processing, refreshing in 20 seconds...
#  BLAST alignment processing, refreshing in 20 seconds...
#  BLAST alignment processing, refreshing in 20 seconds...
#  BLAST alignment processing, refreshing in 20 seconds...
#  BLAST alignment processing, refreshing in 20 seconds...
#  BLAST alignment processing, refreshing in 20 seconds...
#  BLAST alignment processing, refreshing in 20 seconds...
#  BLAST alignment completed in 151 seconds
#  500 BLAST alignments parsed in 1 seconds
#  Loading required package: XML
#  taxonomy retrieved in 11 seconds
#  500 sequences retrieved from NCBI in 144 seconds, product length min:739 mean:745.94 max:747
#  500 sequences aligned in 55 seconds length:747
#  pairwise DNA distances calculated in 0 seconds
#  constructed neighbor joining tree in 0 seconds
trnH<-search_primer_pair(name="trnH","GTTATGCATGAACGTAATGCTC","CGCGCATGGTGGATTCACAATCC")
#  BLASTing 1 primer combinations
#  Submitting Primer-BLAST query
#  BLAST alignment processing, refreshing in 20 seconds...
#  BLAST alignment processing, refreshing in 20 seconds...
#  BLAST alignment processing, refreshing in 20 seconds...
#  BLAST alignment processing, refreshing in 20 seconds...
#  BLAST alignment completed in 90 seconds
#  500 BLAST alignments parsed in 1 seconds
#  taxonomy retrieved in 7 seconds
#  500 sequences retrieved from NCBI in 92 seconds, product length min:179 mean:448.04 max:755
#  500 sequences aligned in 34 seconds length:832
#  pairwise DNA distances calculated in 0 seconds
#  constructed neighbor joining tree in 1 seconds
MVesuviusC commented 10 years ago

We still have R 3.0.1 and so I can't install your version from cran. I'll get R updated and get back to you. Thanks

jimhester commented 10 years ago

The CRAN version is old, just make sure you have the latest github version On Jan 22, 2014 4:54 PM, "MVesuviusC" notifications@github.com wrote:

We still have R 3.0.1 and so I can't install your version from cran. I'll get R updated and get back to you. Thanks

— Reply to this email directly or view it on GitHubhttps://github.com/jimhester/primerTree/issues/7#issuecomment-33072898 .

MVesuviusC commented 10 years ago

Still no new version of R, but I grabbed the github version and am still getting the same error: Perhaps there is some dependency that I need to update?

library(devtools) install_github(user='jimhester', repo='primerTree') Installing github repo(s) primerTree/master from jimhester Installing primerTree.zip from https://github.com/jimhester/primerTree/archive/master.zip Installing primerTree '/usr/lib64/R/bin/R' --vanilla CMD INSTALL '/tmp/Rtmp0ocDxm/primerTree-master' \ --library='/home/cannonm3/R/x86_64-redhat-linux-gnu-library/3.0' --with-keep.source

  • installing source package 'primerTree' ... * libs gcc -m64 -std=gnu99 -I/usr/include/R -DNDEBUG -I/usr/local/include -fpic -O2 -g -pipe -Wall -Wp,-D_FORTIFY_SOURCE=2 -fexceptions -fstack-protector --param=ssp-buffer-size=4 -m64 -mtune=generic -c read_dna.c -o read_dna.o read_dna.c: In function 'rawStreamToDNAbin': read_dna.c:127: warning: pointer targets in passing argument 1 of 'Rf_mkChar' differ in signedness gcc -m64 -std=gnu99 -shared -L/usr/local/lib64 -o primerTree.so read_dna.o -L/usr/lib64/R/lib -lR installing to /home/cannonm3/R/x86_64-redhat-linux-gnu-library/3.0/primerTree/libs * R \ data * moving datasets to lazyload DB * preparing package for lazy loading * help * installing help indices converting help for package 'primerTree' finding HTML links ... done accession2gi html
    bryophytes_trnL html
    clustalo html
    get_sequence html 
finding level-2 HTML links ... done

get_sequences                           html  
get_taxonomy                            html  
gi2taxid                                html  
identify.primerTree_plot                html  
layout_tree_ape                         html  
mammals_16S                             html  
plot.primerTree                         html  
plot_tree                               html  
plot_tree_ranks                         html  
primerTree                              html  
primer_search                           html  
search_primer_pair                      html  
summary.primerTree                      html  
tree_from_alignment                     html

* building package indices * testing if installed package can be loaded

test = search_primer_pair(name="BirdCOI","TTCTCCAACCACAAAGACATTGGCAC","ACGTGGGAGATAATTCCAAATCCTG") BLASTing 1 primer combinations Submitting Primer-BLAST query BLAST alignment processing, refreshing in 20 seconds... BLAST alignment processing, refreshing in 20 seconds... BLAST alignment processing, refreshing in 20 seconds... BLAST alignment processing, refreshing in 20 seconds... BLAST alignment processing, refreshing in 20 seconds... BLAST alignment completed in 110 seconds 500 BLAST alignments parsed in 2 seconds taxonomy retrieved in 11 seconds Error in from:to : result would be too long a vector In addition: Warning messages: 1: In max(i) : no non-missing arguments to max; returning -Inf 2: In max(i) : no non-missing arguments to max; returning -Inf Error in from:to : result would be too long a vector In addition: Warning messages: 1: In max(i) : no non-missing arguments to max; returning -Inf 2: In max(i) : no non-missing arguments to max; returning -Inf Error in from:to : result would be too long a vector In addition: Warning messages: 1: In max(i) : no non-missing arguments to max; returning -Inf 2: In max(i) : no non-missing arguments to max; returning -Inf Error in from:to : result would be too long a vector In addition: Warning messages: 1: In max(i) : no non-missing arguments to max; returning -Inf 2: In max(i) : no non-missing arguments to max; returning -Inf Error in from:to : result would be too long a vector In addition: Warning messages: 1: In max(i) : no non-missing arguments to max; returning -Inf 2: In max(i) : no non-missing arguments to max; returning -Inf Error in from:to : result would be too long a vector In addition: Warning messages: 1: In max(i) : no non-missing arguments to max; returning -Inf 2: In max(i) : no non-missing arguments to max; returning -Inf Error in from:to : result would be too long a vector In addition: Warning messages: 1: In max(i) : no non-missing arguments to max; returning -Inf 2: In max(i) : no non-missing arguments to max; returning -Inf 500 sequences retrieved from NCBI in 2249 seconds, product length min:1 mean:735.51 max:747 Error in file(con, "rb") : cannot open the connection In addition: Warning message: In file(con, "rb") : cannot open file '/tmp/Rtmp0ocDxm/file119a4a5d7ad2.aln': No such file or directory

names(test) [1] "arguments" "BLAST_result" "name" "response" "sequence" "taxonomy"

jimhester commented 10 years ago

could you do

save(test, file='test.RData')

in R, put the file in your dropbox and send me the link. I can look at it and see if I can figure out what is going on.

On Thu, Jan 23, 2014 at 11:29 AM, MVesuviusC notifications@github.comwrote:

Still no new version of R, but I grabbed the github version and am still getting the same error: Perhaps there is some dependency that I need to update?

library(devtools) install_github(user='jimhester', repo='primerTree') Installing github repo(s) primerTree/master from jimhester Installing primerTree.zip from https://github.com/jimhester/primerTree/archive/master.zip Installing primerTree '/usr/lib64/R/bin/R' --vanilla CMD INSTALL '/tmp/Rtmp0ocDxm/primerTree-master' \ --library='/home/cannonm3/R/x86_64-redhat-linux-gnu-library/3.0' --with-keep.source

-

installing source package 'primerTree' ... * libs gcc -m64 -std=gnu99 -I/usr/include/R -DNDEBUG -I/usr/local/include -fpic -O2 -g -pipe -Wall -Wp,-D_FORTIFY_SOURCE=2 -fexceptions -fstack-protector --param=ssp-buffer-size=4 -m64 -mtune=generic -c read_dna.c -o read_dna.o read_dna.c: In function 'rawStreamToDNAbin': read_dna.c:127: warning: pointer targets in passing argument 1 of 'Rf_mkChar' differ in signedness gcc -m64 -std=gnu99 -shared -L/usr/local/lib64 -o primerTree.so read_dna.o -L/usr/lib64/R/lib -lR installing to /home/cannonm3/R/x86_64-redhat-linux-gnu-library/3.0/primerTree/libs * R \ data * moving datasets to lazyload DB * preparing package for lazy loading * help * installing help indices converting help for package 'primerTree' finding HTML links ... done accession2gi html

bryophytes_trnL html

clustalo html

get_sequence html

finding level-2 HTML links ... done

get_sequences html

get_taxonomy html

gi2taxid html

identify.primerTree_plot html

layout_tree_ape html

mammals_16S html

plot.primerTree html

plot_tree html

plot_tree_ranks html

primerTree html

primer_search html

search_primer_pair html

summary.primerTree html

tree_from_alignment html

* building package indices * testing if installed package can be loaded

  • DONE (primerTree) > library(primerTree) Loading required package: directlabels Loading required package: grid Loading required package: gridExtra

test = search_primer_pair(name="BirdCOI","TTCTCCAACCACAAAGACATTGGCAC","ACGTGGGAGATAATTCCAAATCCTG")

BLASTing 1 primer combinations Submitting Primer-BLAST query BLAST alignment processing, refreshing in 20 seconds... BLAST alignment processing, refreshing in 20 seconds... BLAST alignment processing, refreshing in 20 seconds... BLAST alignment processing, refreshing in 20 seconds... BLAST alignment processing, refreshing in 20 seconds... BLAST alignment completed in 110 seconds 500 BLAST alignments parsed in 2 seconds taxonomy retrieved in 11 seconds

Error in from:to : result would be too long a vector In addition: Warning messages: 1: In max(i) : no non-missing arguments to max; returning -Inf 2: In max(i) : no non-missing arguments to max; returning -Inf Error in from:to : result would be too long a vector In addition: Warning messages: 1: In max(i) : no non-missing arguments to max; returning -Inf 2: In max(i) : no non-missing arguments to max; returning -Inf Error in from:to : result would be too long a vector In addition: Warning messages: 1: In max(i) : no non-missing arguments to max; returning -Inf 2: In max(i) : no non-missing arguments to max; returning -Inf Error in from:to : result would be too long a vector In addition: Warning messages: 1: In max(i) : no non-missing arguments to max; returning -Inf 2: In max(i) : no non-missing arguments to max; returning -Inf Error in from:to : result would be too long a vector In addition: Warning messages: 1: In max(i) : no non-missing arguments to max; returning -Inf 2: In max(i) : no non-missing arguments to max; returning -Inf Error in from:to : result would be too long a vector In addition: Warning messages: 1: In max(i) : no non-missing arguments to max; returning -Inf 2: In max(i) : no non-missing arguments to max; returning -Inf Error in from:to : result would be too long a vector In addition: Warning messages: 1: In max(i) : no non-missing arguments to max; returning -Inf 2: In max(i) : no non-missing arguments to max; returning -Inf 500 sequences retrieved from NCBI in 2249 seconds, product length min:1 mean:735.51 max:747

Error in file(con, "rb") : cannot open the connection In addition: Warning message: In file(con, "rb") : cannot open file '/tmp/Rtmp0ocDxm/file119a4a5d7ad2.aln': No such file or directory

names(test) [1] "arguments" "BLAST_result" "name" "response" "sequence" "taxonomy"

— Reply to this email directly or view it on GitHubhttps://github.com/jimhester/primerTree/issues/7#issuecomment-33140425 .

MVesuviusC commented 10 years ago

Here you go: https://www.dropbox.com/s/tlloo8tk4rck5w1/test.RData I'll try again after we get R updated to see if updating things makes any difference.

jimhester commented 10 years ago

I am able to retrieve the sequences fine here from your data. Try running

test_sequences = get_sequences(test$BLAST_result$gi, test$BLAST_result$product_start, test$BLAST_result$product_stop)

then

print(test_sequences)

and see if you still get the truncated sequences... If you do then can you display the results of get_sequences

On Thu, Jan 23, 2014 at 12:53 PM, MVesuviusC notifications@github.comwrote:

Here you go: https://www.dropbox.com/s/tlloo8tk4rck5w1/test.RData I'll try again after we get R updated to see if updating things makes any difference.

— Reply to this email directly or view it on GitHubhttps://github.com/jimhester/primerTree/issues/7#issuecomment-33149519 .

MVesuviusC commented 10 years ago

test_sequences = get_sequences(test$BLAST_result$gi,test$BLAST_result$product_start, test$BLAST_result$product_stop) Error in from:to : result would be too long a vector In addition: Warning messages: 1: In max(i) : no non-missing arguments to max; returning -Inf 2: In max(i) : no non-missing arguments to max; returning -Inf Error in from:to : result would be too long a vector In addition: Warning messages: 1: In max(i) : no non-missing arguments to max; returning -Inf 2: In max(i) : no non-missing arguments to max; returning -Inf print(test_sequences) 500 DNA sequences in binary format stored in a list.

Mean sequence length: 742.954 Shortest sequence: 1 Longest sequence: 747

Labels: 292389662 292389542 292389474 292389282 292389256 292389070 ...

Base composition: a c g t 0.258 0.322 0.166 0.254

also...

summary(test_sequences) Length Class Mode
292389662 746 -none- raw
292389542 746 -none- raw

cut out a bunch here

292389164 747 -none- raw
292389152 747 -none- raw
292389138 747 -none- raw
292389116 1 -none- logical #<- don't think this is right.....

jimhester commented 10 years ago

And what is the output of your get_sequences

On Thu, Jan 23, 2014 at 2:35 PM, MVesuviusC notifications@github.comwrote:

test_sequences = get_sequences(test$BLAST_result$gi,test$BLAST_result$product_start, test$BLAST_result$product_stop) Error in from:to : result would be too long a vector In addition: Warning messages: 1: In max(i) : no non-missing arguments to max; returning -Inf 2: In max(i) : no non-missing arguments to max; returning -Inf Error in from:to : result would be too long a vector In addition: Warning messages: 1: In max(i) : no non-missing arguments to max; returning -Inf 2: In max(i) : no non-missing arguments to max; returning -Inf print(test_sequences) 500 DNA sequences in binary format stored in a list.

Mean sequence length: 742.954 Shortest sequence: 1 Longest sequence: 747

Labels: 292389662 292389542 292389474 292389282 292389256 292389070 ...

Base composition: a c g t 0.258 0.322 0.166 0.254

also...

summary(test_sequences) Length Class Mode

292389662 746 -none- raw

292389542 746 -none- raw

cut out a bunch here

292389164 747 -none- raw

292389152 747 -none- raw

292389138 747 -none- raw

292389116 1 -none- logical #<- don't think this is right.....

— Reply to this email directly or view it on GitHubhttps://github.com/jimhester/primerTree/issues/7#issuecomment-33159741 .

jimhester commented 10 years ago

just type get_sequences I want to see what the code is

On Thu, Jan 23, 2014 at 4:23 PM, Jim Hester james.f.hester@gmail.comwrote:

And what is the output of your get_sequences

On Thu, Jan 23, 2014 at 2:35 PM, MVesuviusC notifications@github.comwrote:

test_sequences = get_sequences(test$BLAST_result$gi,test$BLAST_result$product_start, test$BLAST_result$product_stop) Error in from:to : result would be too long a vector In addition: Warning messages: 1: In max(i) : no non-missing arguments to max; returning -Inf 2: In max(i) : no non-missing arguments to max; returning -Inf Error in from:to : result would be too long a vector In addition: Warning messages: 1: In max(i) : no non-missing arguments to max; returning -Inf 2: In max(i) : no non-missing arguments to max; returning -Inf print(test_sequences) 500 DNA sequences in binary format stored in a list.

Mean sequence length: 742.954 Shortest sequence: 1 Longest sequence: 747

Labels: 292389662 292389542 292389474 292389282 292389256 292389070 ...

Base composition: a c g t 0.258 0.322 0.166 0.254

also...

summary(test_sequences) Length Class Mode

292389662 746 -none- raw

292389542 746 -none- raw

cut out a bunch here

292389164 747 -none- raw

292389152 747 -none- raw

292389138 747 -none- raw

292389116 1 -none- logical #<- don't think this is right.....

— Reply to this email directly or view it on GitHubhttps://github.com/jimhester/primerTree/issues/7#issuecomment-33159741 .

MVesuviusC commented 10 years ago

get_sequences function(gi, start=NULL, stop=NULL, simplify=TRUE, .parallel=FALSE, .progress='none'){

expand arguments by recycling

args = expand_arguments(gi=gi, start=start, stop=stop)

assign expanded arguments to actual arguments

lapply(seq_along(args), function(i) names(args)[i] <<- args[i])

size = length(gi) get_sequence_itr = function(i){ sequence = get_sequence(gi[i], start[i], stop[i]) } sequences = alply(seq_along(gi), .margins=1, .parallel=.parallel, .progress=.progress, failwith(NA, f=get_sequence_itr)) names = if(simplify) gi else laply(sequences, names) sequences = llply(sequences, [[, 1) names(sequences) = names class(sequences) = 'DNAbin' sequences }

jimhester commented 10 years ago

you seem to have the package functions loaded into your local namespace rather than their package namespace, probably from sourcing the R code manually at some point. You need to start up a new instance of R or rm(list=ls()) to remove the functions from the local namespace.

On Thu, Jan 23, 2014 at 4:32 PM, MVesuviusC notifications@github.comwrote:

get_sequences function(gi, start=NULL, stop=NULL, simplify=TRUE, .parallel=FALSE, .progress='none'){

expand arguments by recycling

args = expand_arguments(gi=gi, start=start, stop=stop)

assign expanded arguments to actual arguments

lapply(seq_along(args), function(i) names(args)[i] <<- args[i])

size = length(gi) get_sequence_itr = function(i){ sequence = get_sequence(gi[i], start[i], stop[i]) } sequences = alply(seq_along(gi), .margins=1, .parallel=.parallel, .progress=.progress, failwith(NA, f=get_sequence_itr)) names = if(simplify) gi else laply(sequences, names) sequences = llply(sequences, [[, 1) names(sequences) = names class(sequences) = 'DNAbin' sequences }

— Reply to this email directly or view it on GitHubhttps://github.com/jimhester/primerTree/issues/7#issuecomment-33170885 .

MVesuviusC commented 10 years ago

started new R session and did rm(list=ls()), still looks the same.

get_sequences

function(gi, start=NULL, stop=NULL, simplify=TRUE, .parallel=FALSE, .progress='none'){

expand arguments by recycling

args = expand_arguments(gi=gi, start=start, stop=stop)

assign expanded arguments to actual arguments

lapply(seq_along(args), function(i) names(args)[i] <<- args[i])

size = length(gi) get_sequence_itr = function(i){ sequence = get_sequence(gi[i], start[i], stop[i]) } sequences = alply(seq_along(gi), .margins=1, .parallel=.parallel, .progress=.progress, failwith(NA, f=get_sequence_itr)) names = if(simplify) gi else laply(sequences, names) sequences = llply(sequences, [[, 1) names(sequences) = names class(sequences) = 'DNAbin' sequences }

jimhester commented 10 years ago

Could you try running

Rscript -e "library(methods);library(devtools);install_github(user='jimhester', 'primerTree');library(primerTree);sink(file='get_sequences.R');get_sequences;sink(NULL);"

and then send me the file get_sequences.R

It should look like the attached file

Sorry this is being such a pain :/

On Thu, Jan 23, 2014 at 4:51 PM, MVesuviusC notifications@github.comwrote:

started new R session and did rm(list=ls()), still looks the same.

get_sequences

function(gi, start=NULL, stop=NULL, simplify=TRUE, .parallel=FALSE, .progress='none'){

expand arguments by recycling

args = expand_arguments(gi=gi, start=start, stop=stop)

assign expanded arguments to actual arguments

lapply(seq_along(args), function(i) names(args)[i] <<- args[i])

size = length(gi) get_sequence_itr = function(i){ sequence = get_sequence(gi[i], start[i], stop[i]) } sequences = alply(seq_along(gi), .margins=1, .parallel=.parallel, .progress=.progress, failwith(NA, f=get_sequence_itr)) names = if(simplify) gi else laply(sequences, names) sequences = llply(sequences, [[, 1) names(sequences) = names class(sequences) = 'DNAbin' sequences }

—

Reply to this email directly or view it on GitHubhttps://github.com/jimhester/primerTree/issues/7#issuecomment-33172988 .

MVesuviusC commented 10 years ago

No worries. There is probably some simple issue I'm overlooking. Here is the file: https://www.dropbox.com/s/ba13m1vb6cne8rb/get_sequences.R

jimhester commented 10 years ago

I am not sure what is going wrong. Possibly it is due to the R version, it is hard for me to debug without being able to reproduce the problem myself. Do you get the same error when you try to run the code on Windows and on the linux boxes?

On Fri, Jan 24, 2014 at 11:25 AM, MVesuviusC notifications@github.comwrote:

No worries. There is probably some simple issue I'm overlooking. Here is the file: https://www.dropbox.com/s/ba13m1vb6cne8rb/get_sequences.R

— Reply to this email directly or view it on GitHubhttps://github.com/jimhester/primerTree/issues/7#issuecomment-33237121 .

MVesuviusC commented 10 years ago

Yeah, I suspect is may have something to do with not having the newest version of some library or somesuch due to my R version. I haven't gotten primerTree to work on the local install of Rstudio I have on my desktop since I don't have clustal installed. I do get the same error through both Rstudio connected to a server and running R on the server directly.

MVesuviusC commented 10 years ago

Ok, I got R updated and updated all of my packages. The one primer set that wasn't working above (trnH) now works but the BirdCOI primer set still gives the same error. I'm a bit stumped. The only thing I notice with the results of the BirdCOI is that for each time the error message pops up, we have an instance in the $sequence part of the object that has no real sequence in it. However, if you take that same gi, and use the get_sequence or get_sequences function directly, it returns a sequence of the right length.... I also have no $alignment part of the object, which I suppose is because it's trying to align empty sequences....

trnH<-search_primer_pair(name="trnH","GTTATGCATGAACGTAATGCTC","CGCGCATGGTGGATTCACAATCC") BLASTing 1 primer combinations Submitting Primer-BLAST query BLAST alignment processing, refreshing in 20 seconds... BLAST alignment processing, refreshing in 20 seconds... BLAST alignment processing, refreshing in 20 seconds... BLAST alignment processing, refreshing in 20 seconds... BLAST alignment completed in 90 seconds 500 BLAST alignments parsed in 3 seconds taxonomy retrieved in 9 seconds 500 sequences retrieved from NCBI in 108 seconds, product length min:179 mean:448.04 max:755 500 sequences aligned in 71 seconds length:826 constructed neighbor joining tree in 3 seconds

BirdCOI<-search_primer_pair(name="BirdCOI","TTCTCCAACCACAAAGACATTGGCAC","ACGTGGGAGATAATTCCAAATCCTG") BLASTing 1 primer combinations Submitting Primer-BLAST query BLAST alignment processing, refreshing in 20 seconds... BLAST alignment processing, refreshing in 20 seconds... BLAST alignment processing, refreshing in 20 seconds... BLAST alignment completed in 70 seconds 500 BLAST alignments parsed in 3 seconds Loading required package: XML taxonomy retrieved in 8 seconds Error in seq.default(max(i), length(lines)) : 'from' cannot be NA, NaN or infinite In addition: Warning messages: 1: In max(i) : no non-missing arguments to max; returning -Inf 2: In max(i) : no non-missing arguments to max; returning -Inf Error in seq.default(max(i), length(lines)) : 'from' cannot be NA, NaN or infinite In addition: Warning messages: 1: In max(i) : no non-missing arguments to max; returning -Inf 2: In max(i) : no non-missing arguments to max; returning -Inf Error in seq.default(max(i), length(lines)) : 'from' cannot be NA, NaN or infinite In addition: Warning messages: 1: In max(i) : no non-missing arguments to max; returning -Inf 2: In max(i) : no non-missing arguments to max; returning -Inf 500 sequences retrieved from NCBI in 1025 seconds, product length min:1 mean:741.47 max:747 Error in file(con, "rb") : cannot open the connection In addition: Warning message: In file(con, "rb") : cannot open file '/tmp/RtmpmQVAls/file673ba9f2038.aln': No such file or directory

jimhester commented 10 years ago

The only thing I can think of is some connections are failing for some reason, but I don't really have any way to figure out why as I cannot reproduce the error. :-/

MVesuviusC commented 10 years ago

Yeah, I'm not sure what the issue is, and if you're not getting the error it's something specific to our servers. Maybe as things update on our end it'll start working again sometime. Thanks for the help.

Date: Thu, 30 Jan 2014 06:38:41 -0800 From: notifications@github.com To: primerTree@noreply.github.com

Subject: Re: [primerTree] Control size of blast hits? (#7)

The only thing I can think of is some connections are failing for some reason, but I don't really have any way to figure out why as I cannot reproduce the error. :-/

— Reply to this email directly or view it on GitHub.