Test data

[MAXINELSX]

Sorry to bother you; I am using this (env_nf) lishuxian@tong2:~/UMInator$ nextflow -c ~/UMInator/testUMInator.conf run ~/UMInator/UMInator.nf -bg --FW_adapter="CAAGCAGAAGACGGCATACGAGAT" --RV_adapter="AATGATACGGCGACCACCGAGATC" --FW_primer="AGRGTTYGATYMTGGCTCAG" --RV_primer="CGACATCGAGGTGCCAAAC" --fastq_files="/autofs/tong1/LSX/lishuxian/lishuxian/test_data/test_reads.fq" --results_dir=/autofs/tong1/LSX/lishuxian/lishuxian/test_data/output --minQ=7 --minLen=3000 --maxLen=6000 --min_UMI_freq=30 --maxF=10 --scripts_dir="$HOME/UMInator/scripts" --medaka_model=r941_min_high_g330 -profile docker -w /tmp/nextflow_run and I have change the testUMInator.conf line 178 to containerOptions = '-v /home:/home -v /autofs/tong1/LSX/lishuxian/lishuxian/test_data:/data -v /autofs/tong1/LSX/lishuxian/lishuxian/test_data/output:/output' according to the former issue in this and it doesn't work... the detail showed (env_nf) lishuxian@tong2:~/UMInator$ nextflow -c ~/UMInator/testUMInator.conf run ~/UMInator/UMInator.nf -bg --FW_adapter="CAAGCAGAAGACGGCATACGAGAT" --RV_adapter="AATGATACGGCGACCACCGAGATC" --FW_primer="AGRGTTYGATYMTGGCTCAG" --RV_primer="CGACATCGAGGTGCCAAAC" --fastq_files="/autofs/tong1/LSX/lishuxian/lishuxian/test_data/test_reads.fq" --results_dir=/autofs/tong1/LSX/lishuxian/lishuxian/test_data/output --minQ=7 --minLen=3000 --maxLen=6000 --min_UMI_freq=30 --maxF=10 --scripts_dir="$HOME/UMInator/scripts" --medaka_model=r941_min_high_g330 -profile docker -w /tmp/nextflow_run

(env_nf) lishuxian@tong2:~/UMInator$ (env_nf) lishuxian@tong2:~/UMInator$ N E X T F L O W ~ version 23.10.1 Launching /home/lishuxian/UMInator/UMInator.nf [golden_wescoff] DSL2 - revision: b6a013ff48 [69/f42a71] Submitted process > readsFiltering (1) [fc/2a7749] Submitted process > candidateUMIsExtraction (1) ERROR ~ Error executing process > 'candidateUMIsExtraction (1)'

Caused by: Process candidateUMIsExtraction (1) terminated with an error exit status (1)

Command executed:

mkdir -p /autofs/tong1/LSX/lishuxian/lishuxian/test_data/output mkdir -p /autofs/tong1/LSX/lishuxian/lishuxian/test_data/output/candidateUMIsExtraction mkdir -p /autofs/tong1/LSX/lishuxian/lishuxian/test_data/output/candidateUMIsExtraction/test_reads

obtain reverse complement of primers and adapters sequences

FW_primer_R=$(echo -e ">tmp\n" AGRGTTYGATYMTGGCTCAG | seqtk seq -r - | grep -v "^>" | tr -d ' ') RV_primer_R=$(echo -e ">tmp\n" CGACATCGAGGTGCCAAAC | seqtk seq -r - | grep -v "^>" | tr -d ' ') FW_adapter_R=$(echo -e ">tmp\n" CAAGCAGAAGACGGCATACGAGAT | seqtk seq -r - | grep -v "^>" | tr -d ' ') RV_adapter_R=$(echo -e ">tmp\n" AATGATACGGCGACCACCGAGATC | seqtk seq -r - | grep -v "^>" | tr -d ' ')

double UMI design

obtain first and last bases of reads

READS_START=/autofs/tong1/LSX/lishuxian/lishuxian/test_data/output/candidateUMIsExtraction/test_reads/first_200bp.fastq READS_END=/autofs/tong1/LSX/lishuxian/lishuxian/test_data/output/candidateUMIsExtraction/test_reads/last_200bp.fastq seqtk trimfq -L 200 /autofs/tong1/LSX/lishuxian/lishuxian/test_data/output/readsFiltering/test_reads/test_reads_filtered.fastq > $READS_START seqtk seq -r /autofs/tong1/LSX/lishuxian/lishuxian/test_data/output/readsFiltering/test_reads/test_reads_filtered.fastq | seqtk trimfq -L 200 - | seqtk seq -r - > $READS_END

search candidate UMIs with exact length between adapters and primers

cutadapt -j 1 -e 0.2 -O 11 -m 18 -M 18 --discard-untrimmed --match-read-wildcards -g CAAGCAGAAGACGGCATACGAGAT...AGRGTTYGATYMTGGCTCAG -g AATGATACGGCGACCACCGAGATC...CGACATCGAGGTGCCAAAC -G $RV_primer_R...$RV_adapter_R -G $FW_primer_R...$FW_adapter_R -o /autofs/tong1/LSX/lishuxian/lishuxian/test_data/output/candidateUMIsExtraction/test_reads/UMI_part1_db_tmp1.fastq -p /autofs/tong1/LSX/lishuxian/lishuxian/test_data/output/candidateUMIsExtraction/test_reads/UMI_part2_db_tmp1.fastq $READS_START $READS_END

collapse the 5' and 3' end UMIs of each read

paste -d "" <( sed -n '1~4s/^@/>/p;2~4p' /autofs/tong1/LSX/lishuxian/lishuxian/test_data/output/candidateUMIsExtraction/test_reads/UMI_part1_db_tmp1.fastq ) <( sed -n '1~4s/^@/>/p;2~4p' /autofs/tong1/LSX/lishuxian/lishuxian/test_data/output/candidateUMIsExtraction/test_reads/UMI_part2_db_tmp1.fastq ) | cut -d " " -f1 > /autofs/tong1/LSX/lishuxian/lishuxian/test_data/output/candidateUMIsExtraction/test_reads/UMI_db_tmp1.fasta

search candidate UMIs with approximate length between adapters and primers

cutadapt -j 1 -e 0.2 -O 11 -m 18 -l 18 --discard-untrimmed --match-read-wildcards -g CAAGCAGAAGACGGCATACGAGAT -g AATGATACGGCGACCACCGAGATC -G $RV_primer_R -G $FW_primer_R -o /autofs/tong1/LSX/lishuxian/lishuxian/test_data/output/candidateUMIsExtraction/test_reads/UMI_part1_candidates.fastq -p /autofs/tong1/LSX/lishuxian/lishuxian/test_data/output/candidateUMIsExtraction/test_reads/UMI_part2_candidates.fastq $READS_START $READS_END

collapse the 5' and 3' end UMIs of each read

paste -d "" <( sed -n '1~4s/^@/>/p;2~4p' /autofs/tong1/LSX/lishuxian/lishuxian/test_data/output/candidateUMIsExtraction/test_reads/UMI_part1_candidates.fastq ) <( sed -n '1~4s/^@/>/p;2~4p' /autofs/tong1/LSX/lishuxian/lishuxian/test_data/output/candidateUMIsExtraction/test_reads/UMI_part2_candidates.fastq ) | cut -d " " -f1 > /autofs/tong1/LSX/lishuxian/lishuxian/test_data/output/candidateUMIsExtraction/test_reads/UMI_candidates.fastq

convert UMI candidates to fasta

seqtk seq -A /autofs/tong1/LSX/lishuxian/lishuxian/test_data/output/candidateUMIsExtraction/test_reads/UMI_candidates.fastq > /autofs/tong1/LSX/lishuxian/lishuxian/test_data/output/candidateUMIsExtraction/test_reads/UMI_candidates.fasta

Command exit status: 1

Command output: (empty)

Command error: WARNING: Your kernel does not support swap limit capabilities or the cgroup is not mounted. Memory limited without swap. [E::stk_trimfq] failed to open the input file/stream.

Work dir: /tmp/nextflow_run/fc/2a774916efa78a25afa295547fc27c

Tip: you can try to figure out what's wrong by changing to the process work dir and showing the script file named .command.sh

-- Check '.nextflow.log' file for details

and the nextflow.log

(env_nf) lishuxian@tong2:~/UMInator$ tail .nextflow.log Apr-03 17:40:43.327 [Task monitor] DEBUG nextflow.Session - Session aborted -- Cause: Process candidateUMIsExtraction (1) terminated with an error exit status (1) Apr-03 17:40:43.362 [main] DEBUG nextflow.Session - Session await > all processes finished Apr-03 17:40:43.363 [Task monitor] DEBUG nextflow.Session - The following nodes are still active: [process] primersTrimming

Apr-03 17:40:43.372 [main] DEBUG nextflow.Session - Session await > all barriers passed Apr-03 17:40:43.373 [Task monitor] DEBUG n.processor.TaskPollingMonitor - <<< barrier arrives (monitor: local) - terminating tasks monitor poll loop Apr-03 17:40:43.379 [main] DEBUG n.trace.WorkflowStatsObserver - Workflow completed > WorkflowStats[succeededCount=1; failedCount=1; ignoredCount=0; cachedCount=0; pendingCount=0; submittedCount=0; runningCount=0; retriesCount=0; abortedCount=0; succeedDuration=1.1s; failedDuration=624ms; cachedDuration=0ms;loadCpus=0; loadMemory=0; peakRunning=1; peakCpus=1; peakMemory=10 GB; ] Apr-03 17:40:43.386 [main] DEBUG nextflow.cache.CacheDB - Closing CacheDB done Apr-03 17:40:43.397 [main] DEBUG nextflow.script.ScriptRunner - > Execution complete -- Goodbye

Looking forward to your reply; massive thanks

[MaestSi]

Hi, I think this may be the problem: containerOptions = '-v /home:/home -v /autofs/tong1/LSX/lishuxian/lishuxian/test_data:/data -v /autofs/tong1/LSX/lishuxian/lishuxian/test_data/output:/output' With that instruction, it means that /autofs/tong1/LSX/lishuxian/lishuxian/test_data path on your server should be accessed by the Docker container in /data, and your paths for --fastq_files and --resultsDir should contain /data in place of /autofs/tong1/LSX/lishuxian/lishuxian/test_data/. So, you should either adjust the paths specified in your variables accordingly, or mount the directories of interest in a directory accessible to Docker with exactly the same path (as you did for -v /home:/home). I hope this solves the issue! SM

[MAXINELSX]

Hi,

Thank you for your quick response and guidance.

After following your advice, I modified the containerOptions in the testUMInator.conf file to include the necessary volume mappings. Here is the updated line: containerOptions = '-v /home:/home -v /autofs/tong1/LSX/lishuxian/lishuxian/test_data:/autofs/tong1/LSX/lishuxian/lishuxian/test_data' Your assistance was invaluable in resolving the issues I was encountering, and I greatly appreciate your help!

Best regards, Max

[MAXINELSX]

Hi,

Thank you for your quick response and guidance.

After following your advice, I modified the containerOptions in the testUMInator.conf file to include the necessary volume mappings. Here is the updated line: containerOptions = '-v /home:/home -v /autofs/tong1/LSX/lishuxian/lishuxian/test_data:/autofs/tong1/LSX/lishuxian/lishuxian/test_data' Your assistance was invaluable in resolving the issues I was encountering, and I greatly appreciate your help!

Best regards, Max

primersTrimming (1)

sorry for bothering you again, there is a new issue;

(env_nf) lishuxian@tong2:~$ nextflow -c ~/UMInator/2UMInator.conf run ~/UMInator/UMInator.nf -bg --FW_adapter="CAAGCAGAAGACGGCATACGAGAT" --RV_adapter="AATGATACGGCGACCACCGAGATC" --FW_primer="AGRGTTYGATYMTGGCTCAG" --RV_primer="CGACATCGAGGTGCCAAAC" --fastq_files="/autofs/tong1/LSX/lishuxian/lishuxian/test_data/test_reads.fq" --results_dir=/autofs/tong1/LSX/lishuxian/lishuxian/test_data/output --minQ=7 --minLen=3000 --maxLen=6000 --min_UMI_freq=30 --maxF=10 --scripts_dir="$HOME/UMInator/scripts" --medaka_model=r941_min_high_g330 -profile docker (env_nf) lishuxian@tong2:~$ N E X T F L O W ~ version 23.10.1 Launching /home/lishuxian/UMInator/UMInator.nf [sharp_bose] DSL2 - revision: b6a013ff48 [8a/f8d88a] Submitted process > readsFiltering (1) [77/e84941] Submitted process > candidateUMIsExtraction (1) [07/1d6e78] Submitted process > candidateUMIsFiltering (1) [4b/fcc555] Submitted process > readsUMIsAssignment (1) [37/a498a2] Submitted process > draftConsensusCalling (1) [42/bac2bc] Submitted process > draftConsensusCalling (6) [85/760a18] Submitted process > draftConsensusCalling (3) [69/2dbcc1] Submitted process > draftConsensusCalling (7) [b3/a6f9c3] Submitted process > draftConsensusCalling (5) [b8/c1f0f1] Submitted process > draftConsensusCalling (2) [00/a74fb9] Submitted process > draftConsensusCalling (9) [2e/cdf49e] Submitted process > draftConsensusCalling (8) [a6/09014c] Submitted process > draftConsensusCalling (4) [ce/f1a1db] Submitted process > consensusPolishing (1) [5a/d68e00] Submitted process > consensusPolishing (2) [8a/ac99d4] Submitted process > consensusPolishing (3) [18/7edc5a] Submitted process > consensusPolishing (4) [05/1cc2a5] Submitted process > consensusPolishing (5) [f4/cfb215] Submitted process > consensusPolishing (6) [1a/31949e] Submitted process > consensusPolishing (7) [47/48b36c] Submitted process > consensusPolishing (8) [bc/0aaf9c] Submitted process > consensusPolishing (9) [de/4f1e06] Submitted process > QC (1) [7f/63b9e0] Submitted process > primersTrimming (1) ERROR ~ Error executing process > 'primersTrimming (1)'

Caused by: Process primersTrimming (1) terminated with an error exit status (1)

Command executed:

mkdir -p /autofs/tong1/LSX/lishuxian/lishuxian/test_data/output/primersTrimming mkdir -p /autofs/tong1/LSX/lishuxian/lishuxian/test_data/output/primersTrimming/test_reads

find consensus sequences for all UMIs of one sample and concatenate them

polished_consensus=$(find /autofs/tong1/LSX/lishuxian/lishuxian/test_data/output/consensusPolishing/test_reads | grep "_polished_consensus.fasta") cat $polished_consensus > /autofs/tong1/LSX/lishuxian/lishuxian/test_data/output/primersTrimming/test_reads/test_reads_consensus_polished.fasta

obtain reverse complement of primers and adapters sequences

FW_primer_R=$(echo -e ">tmp\n" AGRGTTYGATYMTGGCTCAG | seqtk seq -r - | grep -v "^>" | tr -d ' ') RV_primer_R=$(echo -e ">tmp\n" CGACATCGAGGTGCCAAAC | seqtk seq -r - | grep -v "^>" | tr -d ' ')

trim PCR primers and external sequence

if [[ -f "/autofs/tong1/LSX/lishuxian/lishuxian/test_data/output/primersTrimming/test_reads/test_reads_consensus_polished.fasta" ]]; then cutadapt -j 4 -e 0 --discard-untrimmed --match-read-wildcards -g AGRGTTYGATYMTGGCTCAG -g $RV_primer_R -a CGACATCGAGGTGCCAAAC -a $FW_primer_R -m 3000 -M 6000 -o /autofs/tong1/LSX/lishuxian/lishuxian/test_data/output/primersTrimming/test_reads/test_reads_consensus_polished_primersTrimmed.fasta /autofs/tong1/LSX/lishuxian/lishuxian/test_data/output/primersTrimming/test_reads/test_reads_consensus_polished.fasta fi

Command exit status: 1

Command output: (empty)

Command error: WARNING: Your kernel does not support swap limit capabilities or the cgroup is not mounted. Memory limited without swap.

Work dir: /home/lishuxian/work/7f/63b9e065568c5aebebe840fcfa145a The code is the same as nextflow -c ~/UMInator/UMInator.conf run ~/UMInator/UMInator.nf -bg --FW_adapter="CAAGCAGAAGACGGCATACGAGAT" --RV_adapter="AATGATACGGCGACCACCGAGATC" --FW_primer="AGRGTTYGATYMTGGCTCAG" --RV_primer="CGACATCGAGGTGCCAAAC" --fastq_files="/autofs/tong1/LSX/lishuxian/lishuxian/test_data/test_reads.fq" --results_dir=/autofs/tong1/LSX/lishuxian/lishuxian/test_data/output --minQ=7 --minLen=3000 --maxLen=6000 --min_UMI_freq=30 --maxF=10 --scripts_dir="$HOME/UMInator/scripts" --medaka_model=r941_min_high_g330 -profile docker and I only changed the 178 line to containerOptions = '-v /home:/home -v /autofs/tong1/LSX/lishuxian/lishuxian/test_data:/autofs/tong1/LSX/lishuxian/lishuxian/test_data'

[MAXINELSX]

So sorry for bothering you again.

[MaestSi]

Hi, please check whether the previous processes completed successfully. In particular, please check if you have draft and polished consensus sequences files and, if yes, what they contain (you can run assembly-stats for that). SM

[MAXINELSX]

the last folder contains is consensusPolishing ： (env_nf) lishuxian@tong2:/autofs/tong1/LSX/lishuxian/lishuxian/test_data/2output/consensusPolishing/test_reads$ ll total 0 drwxr-xr-x 11 root root 154 Apr 3 20:38 ./ drwxr-xr-x 3 root root 32 Apr 3 20:38 ../ drwxr-xr-x 3 root root 251 Apr 3 20:38 umi1/ drwxr-xr-x 3 root root 250 Apr 3 20:38 umi2/ drwxr-xr-x 3 root root 251 Apr 3 20:38 umi3/ drwxr-xr-x 3 root root 250 Apr 3 20:38 umi4/ drwxr-xr-x 3 root root 250 Apr 3 20:38 umi5/ drwxr-xr-x 3 root root 250 Apr 3 20:38 umi6/ drwxr-xr-x 3 root root 250 Apr 3 20:38 umi7/ drwxr-xr-x 3 root root 250 Apr 3 20:38 umi8/ drwxr-xr-x 3 root root 250 Apr 3 20:38 umi9/ run assembly-stats (env_nf) lishuxian@tong2:/autofs/tong1/LSX/lishuxian/lishuxian/test_data/2output/consensusPolishing/test_reads$ assembly-stats /fasta stats for umi1/umi1_polished_consensus_tmp.fasta sum = 4463, n = 1, ave = 4463.00, largest = 4463 N50 = 4463, n = 1 N60 = 4463, n = 1 N70 = 4463, n = 1 N80 = 4463, n = 1 N90 = 4463, n = 1 N100 = 4463, n = 1 N_count = 0 Gaps = 0

stats for umi2/umi2_polished_consensus_tmp.fasta sum = 4715, n = 1, ave = 4715.00, largest = 4715 N50 = 4715, n = 1 N60 = 4715, n = 1 N70 = 4715, n = 1 N80 = 4715, n = 1 N90 = 4715, n = 1 N100 = 4715, n = 1 N_count = 0 Gaps = 0

stats for umi3/umi3_polished_consensus_tmp.fasta sum = 4463, n = 1, ave = 4463.00, largest = 4463 N50 = 4463, n = 1 N60 = 4463, n = 1 N70 = 4463, n = 1 N80 = 4463, n = 1 N90 = 4463, n = 1 N100 = 4463, n = 1 N_count = 0 Gaps = 0

stats for umi4/umi4_polished_consensus_tmp.fasta sum = 4565, n = 1, ave = 4565.00, largest = 4565 N50 = 4565, n = 1 N60 = 4565, n = 1 N70 = 4565, n = 1 N80 = 4565, n = 1 N90 = 4565, n = 1 N100 = 4565, n = 1 N_count = 0 Gaps = 0

stats for umi5/umi5_polished_consensus_tmp.fasta sum = 4714, n = 1, ave = 4714.00, largest = 4714 N50 = 4714, n = 1 N60 = 4714, n = 1 N70 = 4714, n = 1 N80 = 4714, n = 1 N90 = 4714, n = 1 N100 = 4714, n = 1 N_count = 0 Gaps = 0

stats for umi6/umi6_polished_consensus_tmp.fasta sum = 4713, n = 1, ave = 4713.00, largest = 4713 N50 = 4713, n = 1 N60 = 4713, n = 1 N70 = 4713, n = 1 N80 = 4713, n = 1 N90 = 4713, n = 1 N100 = 4713, n = 1 N_count = 0 Gaps = 0

stats for umi7/umi7_polished_consensus_tmp.fasta sum = 4463, n = 1, ave = 4463.00, largest = 4463 N50 = 4463, n = 1 N60 = 4463, n = 1 N70 = 4463, n = 1 N80 = 4463, n = 1 N90 = 4463, n = 1 N100 = 4463, n = 1 N_count = 0 Gaps = 0

stats for umi8/umi8_polished_consensus_tmp.fasta sum = 4564, n = 1, ave = 4564.00, largest = 4564 N50 = 4564, n = 1 N60 = 4564, n = 1 N70 = 4564, n = 1 N80 = 4564, n = 1 N90 = 4564, n = 1 N100 = 4564, n = 1 N_count = 0 Gaps = 0

stats for umi9/umi9_polished_consensus_tmp.fasta sum = 4559, n = 1, ave = 4559.00, largest = 4559 N50 = 4559, n = 1 N60 = 4559, n = 1 N70 = 4559, n = 1 N80 = 4559, n = 1 N90 = 4559, n = 1 N100 = 4559, n = 1 N_count = 0 Gaps = 0 (env_nf) lishuxian@tong2:/autofs/tong1/LSX/lishuxian/lishuxian/test_data/2output/consensusPolishing/test_reads$ assembly-stats /fasta stats for umi1/umi1_polished_consensus_tmp.fasta sum = 4463, n = 1, ave = 4463.00, largest = 4463 N50 = 4463, n = 1 N60 = 4463, n = 1 N70 = 4463, n = 1 N80 = 4463, n = 1 N90 = 4463, n = 1 N100 = 4463, n = 1 N_count = 0 Gaps = 0

stats for umi2/umi2_polished_consensus_tmp.fasta sum = 4715, n = 1, ave = 4715.00, largest = 4715 N50 = 4715, n = 1 N60 = 4715, n = 1 N70 = 4715, n = 1 N80 = 4715, n = 1 N90 = 4715, n = 1 N100 = 4715, n = 1 N_count = 0 Gaps = 0

stats for umi3/umi3_polished_consensus_tmp.fasta sum = 4463, n = 1, ave = 4463.00, largest = 4463 N50 = 4463, n = 1 N60 = 4463, n = 1 N70 = 4463, n = 1 N80 = 4463, n = 1 N90 = 4463, n = 1 N100 = 4463, n = 1 N_count = 0 Gaps = 0

stats for umi4/umi4_polished_consensus_tmp.fasta sum = 4565, n = 1, ave = 4565.00, largest = 4565 N50 = 4565, n = 1 N60 = 4565, n = 1 N70 = 4565, n = 1 N80 = 4565, n = 1 N90 = 4565, n = 1 N100 = 4565, n = 1 N_count = 0 Gaps = 0

stats for umi5/umi5_polished_consensus_tmp.fasta sum = 4714, n = 1, ave = 4714.00, largest = 4714 N50 = 4714, n = 1 N60 = 4714, n = 1 N70 = 4714, n = 1 N80 = 4714, n = 1 N90 = 4714, n = 1 N100 = 4714, n = 1 N_count = 0 Gaps = 0

stats for umi6/umi6_polished_consensus_tmp.fasta sum = 4713, n = 1, ave = 4713.00, largest = 4713 N50 = 4713, n = 1 N60 = 4713, n = 1 N70 = 4713, n = 1 N80 = 4713, n = 1 N90 = 4713, n = 1 N100 = 4713, n = 1 N_count = 0 Gaps = 0

stats for umi7/umi7_polished_consensus_tmp.fasta sum = 4463, n = 1, ave = 4463.00, largest = 4463 N50 = 4463, n = 1 N60 = 4463, n = 1 N70 = 4463, n = 1 N80 = 4463, n = 1 N90 = 4463, n = 1 N100 = 4463, n = 1 N_count = 0 Gaps = 0

stats for umi8/umi8_polished_consensus_tmp.fasta sum = 4564, n = 1, ave = 4564.00, largest = 4564 N50 = 4564, n = 1 N60 = 4564, n = 1 N70 = 4564, n = 1 N80 = 4564, n = 1 N90 = 4564, n = 1 N100 = 4564, n = 1 N_count = 0 Gaps = 0

stats for umi9/umi9_polished_consensus_tmp.fasta sum = 4559, n = 1, ave = 4559.00, largest = 4559 N50 = 4559, n = 1 N60 = 4559, n = 1 N70 = 4559, n = 1 N80 = 4559, n = 1 N90 = 4559, n = 1 N100 = 4559, n = 1 N_count = 0 Gaps = 0

[MaestSi]

Perfect, it seems only the last primersTrimming process had some issues. Does the file ${params.results_dir}/primersTrimming/${sample}/${sample}_consensus_polished.fasta or at least the folder exist? SM

[MAXINELSX]

unfortunately, the file or folder doesn't exist(env_nf) lishuxian@tong2:/autofs/tong1/LSX/lishuxian/lishuxian/test_data/2output/primersTrimming/test_reads$ ll total 0 drwxr-xr-x 2 root root 10 Apr 3 20:39 ./ drwxr-xr-x 3 root root 32 Apr 3 20:39 ../

[MaestSi]

Difficult to say, I don't see any specific errors. Please try removing the output folder and rerunning it again. SM

[MAXINELSX]

I have tried this with changing the --results_dir=/autofs/tong1/LSX/lishuxian/lishuxian/test_data/output to --results_dir=/autofs/tong1/LSX/lishuxian/lishuxian/test_data/2output --results_dir=/autofs/tong1/LSX/lishuxian/lishuxian/test_data/3output I find all three output have the same problem

[MAXINELSX]

Since this is the last step; I can manually cut adapter. with cutadapt cutadapt -j 4 -e 0 --discard-untrimmed --match-read-wildcards \ -g CAAGCAGAAGACGGCATACGAGAT -a AATGATACGGCGACCACCGAGATC \ -g AGRGTTYGATYMTGGCTCAG -a CGACATCGAGGTGCCAAAC \ -m 3000 -M 6000 -o test_reads_consensus_polished.fasta all.fasta

[MaestSi]

I think you forgot setting --min_UMI_freq=10, could this be the case? However, this should have resulted in no consensus sequences being produced at all. In any case yes, you can manually concatenate all polished consensus sequences and run the command you reported. At the moment I'm not able to solve the issue, as I don't see any specific errors (just check the requested resources for that process are available). SM

[MAXINELSX]

Still have this: Caused by: Process primersTrimming (1) terminated with an error exit status (1) But I can do this manually! Thank you so much for your professional and prompt response. I appreciate it a lot, it has been already very helpful, thank you so much!

[MaestSi]

Ok, best! SM