Same input, different outputs

[juancresc]

I've realized that I have the same miRNA with different names but returning different cleavage sites

This is the output of my data, I'm using the next miRNA lib

>31509_1
AATTCCGAACGGAGGGAGTAC
>35509_2
AATTCCGAACGGAGGGAGTAC

As you can see in the output, the target sites for each id are different, even if they're the same sequences

# CleaveLand4 4.4
# Wed Apr  5 13:03:26 UTC 2017
# Degradome Density File: data/degradome/sra_data.fasta_dd.txt
# Query Alignment file: data/tae/test.fa_GSTAr.txt
# Transcriptome: data/cds/Triticum_aestivum.TGACv1.cds.all.nowhitespace.fa
# P-value cutoff: 0.01
# Category cutoff: 4
# Output Format: Tabular
SiteID  Query   Transcript  TStart  TStop   TSlice  MFEperfect  MFEsite MFEratio    AllenScore  Paired  Unpaired    Structure   Sequence    DegradomeCategory   DegradomePval   Tplot_file_path
TRIAE_CS42_5DL_TGACv1_433117_AA1402600.1:523    31509_1 TRIAE_CS42_5DL_TGACv1_433117_AA1402600.1    512 532 523 -38.90  -35.60  0.915167095115681   2   1-20,532-513    21-21,512-512[UP3]  .((((((((((((((((((((&)))))))))))))))))))). CUACUCCCUCCGUUUGGAAUU&AAUUCCGAACGGAGGGAGUAC 2   0.00573554225874395 plots3//31509_1_TRIAE_CS42_5DL_TGACv1_433117_AA1402600.1_523_TPlot.pdf
TRIAE_CS42_7DL_TGACv1_602835_AA1969710.1:659    35509_2 TRIAE_CS42_7DL_TGACv1_602835_AA1969710.1    648 668 659 -38.90  -34.70  0.892030848329049   2   1-20,668-649    21-21,648-648[UP3]  .((((((((((((((((((((&)))))))))))))))))))). AUACUCCCUUCGUUCGGAAUU&AAUUCCGAACGGAGGGAGUAC 1   0.00100094280010721 plots3//35509_2_TRIAE_CS42_7DL_TGACv1_602835_AA1969710.1_659_TPlot.pdf

[MikeAxtell]

This is expected behavior. See the section of the README titled "No redundancy"

Why would you have the exact same miRNA sequence twice in your queries?

On Wed, Apr 5, 2017 at 9:11 AM, juanmas07 notifications@github.com wrote:

I've realized that I have the same miRNA with different names but returning different cleavage sites

This is the output of my data, I'm using the next miRNA lib

31509_1 AATTCCGAACGGAGGGAGTAC 35509_2 AATTCCGAACGGAGGGAGTAC

As you can see in the output, the target sites for each id are different, even if they're the same sequences

CleaveLand4 4.4

Wed Apr 5 13:03:26 UTC 2017

Degradome Density File: data/degradome/sra_data.fasta_dd.txt

Query Alignment file: data/tae/test.fa_GSTAr.txt

Transcriptome: data/cds/Triticum_aestivum.TGACv1.cds.all.nowhitespace.fa

P-value cutoff: 0.01

Category cutoff: 4

Output Format: Tabular

SiteID Query Transcript TStart TStop TSlice MFEperfect MFEsite MFEratio AllenScore Paired Unpaired Structure Sequence DegradomeCategory DegradomePval Tplot_file_path TRIAE_CS42_5DL_TGACv1_433117_AA1402600.1:523 31509_1 TRIAE_CS42_5DL_TGACv1_433117_AA1402600.1 512 532 523 -38.90 -35.60 0.915167095115681 2 1-20,532-513 21-21,512-512[UP3] .((((((((((((((((((((&)))))))))))))))))))). CUACUCCCUCCGUUUGGAAUU&AAUUCCGAACGGAGGGAGUAC 2 0.00573554225874395 plots3//31509_1_TRIAE_CS42_5DL_TGACv1_433117_AA1402600.1_523_TPlot.pdf TRIAE_CS42_7DL_TGACv1_602835_AA1969710.1:659 35509_2 TRIAE_CS42_7DL_TGACv1_602835_AA1969710.1 648 668 659 -38.90 -34.70 0.892030848329049 2 1-20,668-649 21-21,648-648[UP3] .((((((((((((((((((((&)))))))))))))))))))). AUACUCCCUUCGUUCGGAAUU&AAUUCCGAACGGAGGGAGUAC 1 0.00100094280010721 plots3//35509_2_TRIAE_CS42_7DL_TGACv1_602835_AA1969710.1_659_TPlot.pdf

— You are receiving this because you are subscribed to this thread. Reply to this email directly, view it on GitHub https://github.com/MikeAxtell/CleaveLand4/issues/6, or mute the thread https://github.com/notifications/unsubscribe-auth/AGiXiRRpl7jXxFjDst78sPyaIq2AMq2gks5rs5L3gaJpZM4M0N9z .

-- Michael J. Axtell, Ph.D. Professor of Biology Penn State University http://sites.psu.edu/axtell

[juancresc]

That's perfect. The input had a mistake and that's why the issue was generated.