Closed juancresc closed 7 years ago
This is expected behavior. See the section of the README titled "No redundancy"
Why would you have the exact same miRNA sequence twice in your queries?
On Wed, Apr 5, 2017 at 9:11 AM, juanmas07 notifications@github.com wrote:
I've realized that I have the same miRNA with different names but returning different cleavage sites
This is the output of my data, I'm using the next miRNA lib
31509_1 AATTCCGAACGGAGGGAGTAC 35509_2 AATTCCGAACGGAGGGAGTAC
As you can see in the output, the target sites for each id are different, even if they're the same sequences
CleaveLand4 4.4
Wed Apr 5 13:03:26 UTC 2017
Degradome Density File: data/degradome/sra_data.fasta_dd.txt
Query Alignment file: data/tae/test.fa_GSTAr.txt
Transcriptome: data/cds/Triticum_aestivum.TGACv1.cds.all.nowhitespace.fa
P-value cutoff: 0.01
Category cutoff: 4
Output Format: Tabular
SiteID Query Transcript TStart TStop TSlice MFEperfect MFEsite MFEratio AllenScore Paired Unpaired Structure Sequence DegradomeCategory DegradomePval Tplot_file_path TRIAE_CS42_5DL_TGACv1_433117_AA1402600.1:523 31509_1 TRIAE_CS42_5DL_TGACv1_433117_AA1402600.1 512 532 523 -38.90 -35.60 0.915167095115681 2 1-20,532-513 21-21,512-512[UP3] .((((((((((((((((((((&)))))))))))))))))))). CUACUCCCUCCGUUUGGAAUU&AAUUCCGAACGGAGGGAGUAC 2 0.00573554225874395 plots3//31509_1_TRIAE_CS42_5DL_TGACv1_433117_AA1402600.1_523_TPlot.pdf TRIAE_CS42_7DL_TGACv1_602835_AA1969710.1:659 35509_2 TRIAE_CS42_7DL_TGACv1_602835_AA1969710.1 648 668 659 -38.90 -34.70 0.892030848329049 2 1-20,668-649 21-21,648-648[UP3] .((((((((((((((((((((&)))))))))))))))))))). AUACUCCCUUCGUUCGGAAUU&AAUUCCGAACGGAGGGAGUAC 1 0.00100094280010721 plots3//35509_2_TRIAE_CS42_7DL_TGACv1_602835_AA1969710.1_659_TPlot.pdf
— You are receiving this because you are subscribed to this thread. Reply to this email directly, view it on GitHub https://github.com/MikeAxtell/CleaveLand4/issues/6, or mute the thread https://github.com/notifications/unsubscribe-auth/AGiXiRRpl7jXxFjDst78sPyaIq2AMq2gks5rs5L3gaJpZM4M0N9z .
-- Michael J. Axtell, Ph.D. Professor of Biology Penn State University http://sites.psu.edu/axtell
That's perfect. The input had a mistake and that's why the issue was generated.
I've realized that I have the same miRNA with different names but returning different cleavage sites
This is the output of my data, I'm using the next miRNA lib
As you can see in the output, the target sites for each id are different, even if they're the same sequences