Hi:
I am currently using ShortStack to identify sRNA cluster. I am a litter confuse about the parameter '--pad'. for example, I set "--pad 200 ". Is that mean If the distance between two clusters is less than 200, they will be merged together? blow is my results, it seems not like that. or if there are any parameters can do this?
Thank you in advance for your apply!
Locus Name Length Reads RPM UniqueReads FracTop Strand MajorRNA MajorRNAReads Complexity Dic
Hi: I am currently using ShortStack to identify sRNA cluster. I am a litter confuse about the parameter '--pad'. for example, I set "--pad 200 ". Is that mean If the distance between two clusters is less than 200, they will be merged together? blow is my results, it seems not like that. or if there are any parameters can do this? Thank you in advance for your apply!
Locus Name Length Reads RPM UniqueReads FracTop Strand MajorRNA MajorRNAReads Complexity Dic
chr01:117389-117432 Cluster_1 44 12 0.821 12 0.000 - GUGUCCGACUGGCAACCCUGAGCU 5 chr01:119160-119314 Cluster_2 155 39 2.669 36 0.872 + AAGAAUAUUUACCACUCCACCACA 14 chr01:119755-119788 Cluster_3 34 25 1.711 25 1.000 + AAGUAUAGAGUCGAUGAUAGAGCC 6 chr01:130366-130473 Cluster_4 108 16 1.095 15 1.000 + AUUUGAAUUCCUGACUCUGUCACU 9 chr01:131837-131864 Cluster_5 28 9 0.616 9 0.889 + AUAUACGGCUCGGUUAUAGACUAA 6 chr01:137302-137497 Cluster_6 196 116 7.940 107 0.069 - AUGACAUCUCUUCGACUUACCAAG 32 chr01:137616-137728 Cluster_7 113 49 3.354 49 0.816 + AUUCAUCUUCUGAAUGUAGACGUU 7 chr01:140476-140500 Cluster_8 25 8 0.548 8 0.000 - UCGAACUGUUGAAUCUCUUUCAUC 5 chr01:142560-142723 Cluster_9 164 41 2.806 41 0.122 - ACGGUCGGACGACAUGCAAAGUCC 14 chr01:143939-143971 Cluster_10 33 9 0.616 9 0.778 . AUAAGAUCUAUGUAUGUUCUACUC 3 chr01:149433-149485 Cluster_11 53 8 0.548 8 0.250 . ACGUAUCGAAUAAACUCUCGGAUC 2 chr01:184580-184671 Cluster_12 92 97 6.639 97 0.021 - AGAUCUGUGUACACUGAACUUGCC 42 chr01:187833-187857 Cluster_13 25 11 0.753 11 1.000 + AUACCGACUUGCAAUUUAAAAUGA 4 chr01:197122-197205 Cluster_14 84 11 0.753 11 0.818 + AGGGGAGAGUAGAAUGUAAGCGGA 4 chr01:203017-203067 Cluster_15 51 48 3.285 48 0.021 - AAGAUUCUCGAUAUUCUGAUCACC 22 chr01:220725-220812 Cluster_16 88 86 5.886 86 0.035 - AGACUGUCUUAAUUAGCUUGAAGC 81 chr01:229035-229182 Cluster_17 148 16 1.095 6 0.062 - AAUUAAUCGAGAUGUGUGAAAGC 3 0.5 chr01:241771-241809 Cluster_18 39 15 1.027 5 0.133 - ACUGUUUCCGAUAGACUCUCGACU 7 chr01:243129-243202 Cluster_19 74 8 0.548 8 0.000 - CGUAUAUUGCUGAGUUCUCCGAUU 6 chr01:243464-243627 Cluster_20 164 14 0.958 10 0.214 . AGGAGUGGGGGUAAGGUCUGCGUAC 3 chr01:248511-248613 Cluster_21 103 311 21.286 309 0.048 - AAUAUCCGGUACUUGUUUUGAAGU 241 chr01:255354-255445 Cluster_22 92 67 4.586 64 0.418 . UUUCAAUAGACUCUCAAUUCAAGG 15 chr01:255625-255724 Cluster_23 100 10 0.684 10 0.100 - AUAGAUAAAUCUGGCUCGCCUCCC 3