FATAL: bowtie encountered an error!

Hi Mike,

I am new to bioinformatics and would like to analyse smallRNA Seq data using ShortStack.

I have downloaded the test data set to get started and would like to analyse it. I am getting the following error:

(base) Test % ShortStack --genomefile Arabidopsis_thalianaTAIR10.fa --readfile SRR3222443.fastq SRR3222444.fastq SRR3222445.fastq --autotrim --threads 6 --outdir ExampleShortStackRun --known_miRNAs ath_known_miRNAs.fasta

ShortStack version 4.0.4

Beginning run Options: { 'adapter': None, 'align_only': False, 'autotrim': True, 'autotrim_key': 'TCGGACCAGGCTTCATTCCCC', 'bamfile': None, 'dicermax': 24, 'dicermin': 21, 'dn_mirna': False, 'genomefile': 'Arabidopsis_thalianaTAIR10.fa', 'known_miRNAs': 'ath_known_miRNAs.fasta', 'locifile': None, 'locus': None, 'mincov': 1, 'mmap': 'u', 'no_bigwigs': False, 'nohp': False, 'outdir': 'ExampleShortStackRun', 'pad': 200, 'readfile': ['SRR3222443.fastq', 'SRR3222444.fastq', 'SRR3222445.fastq'], 'show_secondaries': False, 'strand_cutoff': 0.8, 'threads': 6} Required executable RNAfold : /Users/xxxx/anaconda3/bin/RNAfold Required executable strucVis : /Users/xxxx/anaconda3/bin/strucVis Required executable bowtie : /Users/xxxx/anaconda3/bin/bowtie Required executable bowtie-build : /Users/xxxx/anaconda3/bin/bowtie-build Required executable ShortTracks : /Users/xxxx/anaconda3/bin/ShortTracks Required executable wigToBigWig : /Users/xxxx/anaconda3/bin/wigToBigWig Required executable cutadapt : /Users/xxxx/anaconda3/bin/cutadapt Required executable samtools : /Users/xxxx/anaconda3/bin/samtools Mon 12 Aug 2024 15:12:14 +0200 CEST

Initiating autotrim with an autotrim_key of TCGGACCAGGCTTCATTCCCC

Adapters:
[('SRR3222443.fastq', 'TGGAATTCTCGGGTGCCAAG'),
('SRR3222444.fastq', 'TGGAATTCTCGGGTGCCAAG'),
('SRR3222445.fastq', 'TGGAATTCTCGGGTGCCAAG')]

Mon 12 Aug 2024 15:12:51 +0200 CEST Initiating read trimming with cutadapt

Trimming readfile SRR3222443.fastq ... Done 00:00:24 7,641,498 reads @ 3.2 µs/read; 18.97 M reads/minute status in_reads in_bp too_short too_long too_many_n out_reads w/adapters qualtrim_bp out_bp OK 7641498 382074900 568519 0 0 6964746 7533265 0 160030151 Completed. Trimmed file is ExampleShortStackRun/tSRR3222443.fastq.

Trimming readfile SRR3222444.fastq ... Done 00:00:28 9,366,086 reads @ 3.0 µs/read; 19.97 M reads/minute status in_reads in_bp too_short too_long too_many_n out_reads w/adapters qualtrim_bp out_bp OK 9366086 468304300 812135 0 0 8232387 9044522 0 193110300 Completed. Trimmed file is ExampleShortStackRun/tSRR3222444.fastq.

Trimming readfile SRR3222445.fastq ... Done 00:00:38 12,937,592 reads @ 3.0 µs/read; 20.05 M reads/minute status in_reads in_bp too_short too_long too_many_n out_reads w/adapters qualtrim_bp out_bp OK 12937592 646879600 1229445 0 0 11602752 12832197 0 268799716 Completed. Trimmed file is ExampleShortStackRun/tSRR3222445.fastq.

Mon 12 Aug 2024 15:14:23 +0200 CEST Required bowtie indices not found. Building them ...

Completed

Beginning alignment phase

Mon 12 Aug 2024 15:16:23 +0200 CEST Aligning ExampleShortStackRun/tSRR3222443.fastq First pass alignment with bowtie using 6 threads 0 bowtie output lines [00:00, ? bowtie output lines/s] FATAL: bowtie encountered an error!

The automatically generated index files seem to be correct, as I can process them without error by manually running bowtie alignment. All files are in the right folder.

I am using Python 3.10.14, ShortStack 4.0.4 and bowtie 1.3.1

Do you have any explanation for this error?

Many thanks in advance Simon

Hello Simon,

I don't know what the issue is here. Command looks fine. I noticed your executables are being managed by anaconda3 instead of the recommended miniconda. I wonder if there is something strange going on with the use of anaconda3?

The error is a generic one which ShortStack triggers if a bowtie call returns a non-zero exit code (see line 1063). You could edit the script to try and see what exact error message bowtie is reporting in this condition.

I don't know of any incompatibilities with the software versions you are using. My test environment uses the same versions as you. I confirmed just now that the test set works on my system.

I would try scrubbing out your Anaconda installation and instead use the recommended miniconda / bioconda method of installing the dependencies. Anaconda IMHO is bloated and in my experience that bloat can do strange things.

Mike

From: Simson896 @.> Date: Monday, August 12, 2024 at 9:21 AM To: MikeAxtell/ShortStack @.> Cc: Subscribed @.***> Subject: [MikeAxtell/ShortStack] FATAL: bowtie encountered an error! (Issue #158)