search

MikeAxtell / ShortStack

ShortStack: Comprehensive annotation and quantification of small RNA genes
MIT License
88 stars 29 forks source link

Double tab in Counts.txt #91

Closed juancresc closed 1 year ago

juancresc commented 5 years ago

Hi!

I've noticed in the Counts.txt, unplaced sRNA have double tab between the main and first condition column.

UUUUAUUAUGAUCCAUUUCGCGUGGAAUUCUGGGUGCCAAGGAACUCCAG NA 114 37 15 37 25 In this case, between 114 and 37. What I had to do to solve this was:

tr -s '\t' '\t' < counts.csv > counts.fixed.csv

This could lead to some issues when doing downstream analysis.

Regards!

acontrerasg commented 5 years ago

Thanks for leaving an easy solution! I was also having troubles with it

MikeAxtell commented 3 years ago

Yikes. I will make sure this gets fixed in the next major release. Actually I think reporting the unplaced sRNAs in the same file as the locus counts was poor decision in the first place, and I intend to separate them in the next major release.

MikeAxtell commented 1 year ago

A new major update to ShortStack, version 4.0, is now in alpha testing: It is available on the ShortStack4 branch. Once we complete alpha testing this will be merged to master and released. But for now you are welcome to test it out. This glitch in the Counts.txt file has been fixed .. the unplaced sRNAs have been removed altogether.