komaljain3
commented
1 year ago Results from Method1:
Trimmed with NEXTflex cutadapt parameters
INPUT_FASTQ=/DCEG/CGF/Research/RD168_Chernobyl_TN-Pairs/ANALYSIS_miR/2023-05-30-miRNA-pipeline-test/sample_test_2018_data/Gencode_microRNA-seq/merged_fastq/SC299521_ATCACG.fastq.gz
SAMPLE=SC299521_ATCACG
export SINGULARITY_BINDPATH=/DCEG/CGF/Research/RD168_Chernobyl_TN-Pairs/ANALYSIS_miR/2023-05-30-miRNA-pipeline-test/sample_test_2018_data/Gencode_microRNA-seq/merged_fastq,/DCEG/CGF/Research/RD168_Chernobyl_TN-Pairs/ANALYSIS_miR/2023-05-30-miRNA-pipeline-test/cutadapt_trim_test
singularity pull docker://quay.io/biocontainers/cutadapt:4.4--py39hf95cd2a_1
singularity exec cutadapt_4.4--py39hf95cd2a_1.sif cutadapt -a TGGAATTCTCGGGTGCCAAGG -o ${SAMPLE}.trim1.fq --minimum-length 23 $INPUT_FASTQ
singularity exec cutadapt_4.4--py39hf95cd2a_1.sif cutadapt -u 4 -u -4 -o ${SAMPLE}.trim2.fq ${SAMPLE}.trim1.fqOutput
Command 1
This is cutadapt 4.4 with Python 3.9.16
Command line parameters: -a TGGAATTCTCGGGTGCCAAGG -o SC299521_ATCACG.trim1.fq --minimum-length 23 /DCEG/CGF/Research/RD168_Chernobyl_TN-Pairs/ANALYSIS_miR/2023-05-30-miRNA-pipeline-test/sample_test_2018_data/Gencode_microRNA-seq/merged_fastq/SC299521_ATCACG.fastq.gz
Processing single-end reads on 1 core ...
Done 00:01:30 28,407,041 reads @ 3.2 µs/read; 18.75 M reads/minute
Finished in 91.523 s (3.222 µs/read; 18.62 M reads/minute).
=== Summary ===
Total reads processed: 28,407,041
Reads with adapters: 28,386 (0.1%)
== Read fate breakdown ==
Reads that were too short: 0 (0.0%)
Reads written (passing filters): 28,407,041 (100.0%)
Total basepairs processed: 1,008,769,132 bp
Total written (filtered): 1,008,657,361 bp (100.0%)
=== Adapter 1 ===
Sequence: TGGAATTCTCGGGTGCCAAGG; Type: regular 3'; Length: 21; Trimmed: 28386 times
Minimum overlap: 3
No. of allowed errors:
1-9 bp: 0; 10-19 bp: 1; 20-21 bp: 2
Bases preceding removed adapters:
A: 21.0%
C: 17.2%
G: 43.6%
T: 18.2%
none/other: 0.0%
Overview of removed sequences
length count expect max.err error counts
3 14927 443860.0 0 14927
4 3335 110965.0 0 3335
5 8424 27741.3 0 8424
6 1260 6935.3 0 1260
7 111 1733.8 0 111
8 87 433.5 0 87
9 46 108.4 0 0 46
10 77 27.1 1 0 77
11 115 6.8 1 0 115
12 4 1.7 1 0 4Command 2
This is cutadapt 4.4 with Python 3.9.16
Command line parameters: -u 4 -u -4 -o SC299521_ATCACG.trim2.fq SC299521_ATCACG.trim1.fq
Processing single-end reads on 1 core ...
Done 00:01:20 28,407,041 reads @ 2.8 µs/read; 21.21 M reads/minute
Finished in 80.966 s (2.850 µs/read; 21.05 M reads/minute).
=== Summary ===
Total reads processed: 28,407,041
Reads written (passing filters): 28,407,041 (100.0%)
Total basepairs processed: 1,008,657,361 bp
Total written (filtered): 781,401,033 bp (77.5%)
Kristie inquired regarding the adapter trimming from the vendor (who provides the sequencing library kit) and the following information was shared with us:
Hello Kristine,
To trim adapters from reads we recommend using cutadapt, setting the minimum insert to 15 bases. Then align your libraries to a miRbase reference for the organism you are studying. I’ve also linked the instructions for v3 here for more detailed instructions. Trimming for v4 is the same just easier (skip step 2).
Best, Allyson
Allyson C. LeBas | Technical Services Support Rep NEXTFLEX NGS PerkinElmer | For the Better
Allyson.LeBas@PerkinElmer.com NGS@PerkinElmer.com Phone: +1 512.707.8993 Mobile: +1 512.708.9904 Fax: +1 512.707.8122 www.perkinelmer.com
Method1: The above email is linked to this doc:
https://perkinelmer-appliedgenomics.com/wp-content/uploads/marketing/NEXTFLEX/miRNA/NEXTflex_Small_RNA_v3_Trimming_Instructions.pdf
The instructions here include:
NEXTflex™ Small RNA Trimming Instructions Sequencing reads generated with the NEXTflex Small RNA Seq Kit v3 require trimming of adapter sequences and random bases prior to alignment when using and end-to-end alignment mode. These trimming steps can be accomplished using cutadapt (https://cutadapt.readthedocs.io/en/stable/), which is free to download.
The following commands require the latest version of cutadapt, which can be installed using the directions found at http://cutadapt.readthedocs.io/en/stable/installation.html.
Trim 3’ adapters: cutadapt -a TGGAATTCTCGGGTGCCAAGG -o YOUR_FILE.trim1.fq --minimum-length 23 YOUR_FILE.fastq.gz This command excludes any inserts less than 15 bases (where the minimum length of 23 refers to 8 randomized bases and a minimum 15-base insert). It takes as input “YOUR_FILE.fastq.gz” and writes out to “YOUR_FILE.trim1.fq”.
Use this command to trim 4 bases from either side of each read: cutadapt -u 4 -u -4 -o YOUR_FILE.trim2.fq YOUR_FILE.trim1.fq From here, you can align “YOUR_FILE.trim2.fq” to an appropriate reference using an aligner such as bowtie2.
Method2: Command used in the old CGR pipeline
cutadapt -b {params.adapter} -m 15 -M 31 --too-short-output={output[1]} --too-long-output={output[2]} -q 10,10 -o {output[0]} {input} 2>log/{wildcards.sample}_cutadapt.err
-m = minimum length (Discard processed reads that are shorter than LENGTH) -M = maximum length (Discard processed reads that are longer than LENGTH) -too short (Instead of discarding the reads that are too short according to -m, write them to FILE (in FASTA/FASTQ format)
--too long (Instead of discarding reads that are too long (according to -M), write them to FILE (in FASTA/FASTQ format)
-q 10, 10 (trim low-quality ends from reads)
The fasta file used for the second method was modified from:
to this new file that also includes the adapter provided by the vendor
The above two methods for trimming were compared and the results are below.