Adapter related options

[gudeqing]

Hi, I found the adapter related options are confusing and give surprising result as show below. In a word: More adapter information may miss rescue some reads! By the way, fastp v0.21.0 is used.

• < Using three adapter related options > /nfs2/software/fastp/fastp -i t1000.R1.fq -I t1000.R2.fq -o t1000.R1.clean.fq -O t1000.R2.clean.fq --adapter_sequence CTGTCTCTTATACACATCTCCGAGCCCACGAGAC --adapter_sequence_r2 CTGTCTCTTATACACATCTGACGCTGCCGACGA --adapter_fasta adapters.fasta Filtering result: reads passed filter: 1274 reads failed due to low quality: 728 reads failed due to too many N: 0 reads failed due to too short: 0 reads with adapter trimmed: 919

• <Using only two adapter related options, without using the --adapter_fasta option> /nfs2/software/fastp/fastp -i t1000.R1.fq -I t1000.R2.fq -o t1000.R1.clean.fq -O t1000.R2.clean.fq --adapter_sequence CTGTCTCTTATACACATCTCCGAGCCCACGAGAC --adapter_sequence_r2 CTGTCTCTTATACACATCTGACGCTGCCGACGA Filtering result: reads passed filter: 1272 ???<1274 reads failed due to low quality: 730 reads failed due to too many N: 0 reads failed due to too short: 0 reads with adapter trimmed: 807

content of adapters.fasta

commonseq2_in_read1 AGGACTCCAAT commonseq1_in_read2 CAAAACGCAATACTGTACATT

Based on Results, we could find that the added 'adapters.fasta' helps to rescue some reads ! So, why would this happen? I think more descriptions are needed for using these options properly.

With Best Regards!

[AlijahArcher]

Looks like without the adapter_fasta there were two additional reads were being filtered out due to quality. My guess is that by adding the adapter_fasta, those two reads that were originally filtered now have a mean quality score that exceeds the default threshold (20).