search

PATRIC3 / patric3_website

Legacy PATRIC Website (JBoss Portal Version)
MIT License
5 stars 2 forks source link

Data API: def line for fasta dna for genomic sequences #593

Closed mshukla1 closed 8 years ago

mshukla1 commented 8 years ago

https://www.patricbrc.org/api/genome_sequence/?eq(genome_id,83332.12)&http_accept=application/dna+fasta

accn|NC_000962 Mycobacterium tuberculosis H37Rv, complete genome. [Mycobacterium tuberculosis H37Rv] ttgaccgatgaccccggttcaggcttcaccacagtgtggaacgcggtcgtctccgaactt aacggcgaccctaaggttgacgacggacccagcagtgatgctaatctcagcgctccgctg

The fasta def line format needs to match the format in the fna file on the ftp site:

accn|NC_000962 Mycobacterium tuberculosis H37Rv, complete genome. [Mycobacterium tuberculosis H37Rv | 83332.12] ttgaccgatgaccccggttcaggcttcaccacagtgtggaacgcggtcgtctccgaactt aacggcgaccctaaggttgacgacggacccagcagtgatgctaatctcagcgctccgctg

However, before making the change, need to make sure it doesn't impact any of the existing services / functionality.

-Maulik

dmachi commented 8 years ago

@levinas will this mess up anything in any of your services?

dmachi commented 8 years ago

I've deployed this to beta for testing.

levinas commented 8 years ago

This should not be a problem for the services I've worked on. Thanks @dmachi for checking with me.

dmachi commented 8 years ago

fixed and deployed to beta.