Closed hitowie closed 10 months ago
Hi @hitowie,
I noticed you have a warning in the logs. Please confirm that your input is correct.
Read group information not found for m54363_231019_004600/37880333/ccs
Also we have recently updated our docs for thecluster2
tool which is a new replacement for cluster
here.
If that does not help please upload a minimal reproducible dataset.
Thank you. I've ran the pipeline again with cluster2
with the same result. I've uploaded my dataset to reproduce the issue.
From what I can tell inspecting all <.bam> files with samtools view -H <.bam> | grep '^@RG'
and samtools view <.bam> | grep 'm54363_231019_004600/37880333/ccs'
the RG exists.
Thank you for uploading your dataset. We are going to investigate and will inform you.
Hi @hitowie. It looks like you did not remove the primers with lima before refine
. I see that the previous lima step was using Sequel_384_barcodes_v1.barcodeset.xml
. If you have a double demux design please run lima
again to remove the isoseq primers. Otherwise, undo demultiplexing and use the primers.fasta
.
$ lima movieX.hifi_reads.bam primers.fasta movieX.fl.bam --isoseq --peek-guess
https://isoseq.how/clustering/cli-workflow.html#step-2---primer-removal-and-demultiplexing
In what way do the target-specific primer sequences influence the downstream analysis? I did targeted sequencing from cDNA with custom primers.
I realized that I provided wrong primer sequences. Here is the correct primers.fasta
file:
>5p
GCAGTCGAACATGTAGCTGACTCAGGTCACTTGTACCAGCTACGGACTGC
>3p
TGGATCACTTGTGCAAGCATCACATCGTAGCGTCCACTCTCTGACATGGG
Now I've ran lima
again to remove those primers.
$ lima <demux.bam> <primers.fasta> <fl.bam> --isoseq --peek-guess --log-level TRACE --log-file lima.log
Here's the fl.lima.summary
ZMWs input (A) : 3089
ZMWs above all thresholds (B) : 3087 (99.94%)
ZMWs below any threshold (C) : 2 (0.06%)
ZMW marginals for (C):
Below min length : 0 (0.00%)
Below min score : 0 (0.00%)
Below min end score : 0 (0.00%)
Below min passes : 0 (0.00%)
Below min score lead : 0 (0.00%)
Below min ref span : 0 (0.00%)
Without SMRTbell adapter : 0 (0.00%)
Undesired 5p--5p pairs : 1 (50.00%)
Undesired 3p--3p pairs : 1 (50.00%)
ZMWs for (B):
With different pair : 3087 (100.00%)
Coefficient of correlation : 0.00%
ZMWs for (A):
Allow diff pair : 3089 (100.00%)
Allow same pair : 3089 (100.00%)
Reads for (B):
Above length : 3087 (100.00%)
Below length : 0 (0.00%)
and fl.lima.counts
IdxFirst IdxCombined IdxFirstNamed IdxCombinedNamed Counts MeanScore
0 1 5p 3p 3087 99
However, the generated fl.5p--3p.bam
file appears empty. Am I missing any filtering options for the lima
primer removal step or why are those 3087 reads not written to BAM?
Hi @hitowie. When I do the following steps I get a non-empty collapsed gff.
lima-undo lima.bc1001--bc1001.Q40.fl.bam undo.bam
lima undo.bam correct_primers.fasta redo.lima.bam --isoseq --peek-guess
isoseq refine redo.lima.5p--3p.bam correct_primers.fasta refine.bam
isoseq cluster2 refine.bam cluster2.bam
pbmm2 align --preset ISOSEQ --sort cluster2.bam mouse_GRCm39.fasta mapped.bam
isoseq collapse --do-not-collapse-extra-5exons mapped.bam collapsed.gff
If this does not work for you, we will have an updated version on Bioconda soon.
Thank you! Primer removal helped. I just had to clear some disk space to write the BAM files. I was able to run isoseq succesfully. Issue is closed.
Operating system Which operating system and version are you using?
Package name Which package / tool is causing the problem? Which version are you using, use
tool --version
. Have you updated to the latest versionconda update package
? Have you updated the complete env by runningconda update --all
? Have you ensured that your channel priorities are set up according to the bioconda recommendations at https://bioconda.github.io/#set-up-channels?Conda environment What is the result of
conda list
? (Try to paste that between triple backticks.)Describe the bug A clear and concise description of what the bug is.
$ isoseq cluster
$ pbmm2 align --preset ISOSEQ --sort
$ isoseq collapse --do-not-collapse-extra-5exons
To Reproduce Steps to reproduce the behavior. Providing a minimal test dataset on which we can reproduce the behavior will generally lead to quicker turnaround time!
Expected behavior A clear and concise description of what you expected to happen.