search

PacificBiosciences / pbbioconda

PacBio Secondary Analysis Tools on Bioconda. Contains list of PacBio packages available via conda.
BSD 3-Clause Clear License
249 stars 44 forks source link

Convert FASTQ in unaligned BAM #668

Closed mariachiara-github closed 6 months ago

mariachiara-github commented 6 months ago

Hi, I'm trying to extract HiFi reads from ccs data. The problem I have is that these ccs data were uploaded in fasta and fastq format on the SRA, and not as BAM files (unaligned BAM). Therefore, the extracthifi command does not work for the extraction of HiFi from ccs. I saw that there is a bam2fastx converter provided by PacBio, so I was wondering if there is a tool or if there is something I can do to convert the fastq files that I have in BAM files.

Just to be clear, the fastq file that I have now looks something like this: @read_name length=... CAATGAAGTCGCAGGGTTGGGGTGGCATTGGAACCCAGTTCTGCCCAGCCCCCAGGAGCCCTTGACATAGCAACATGCTTCCCTAAAGGAGAAAAAAAAATG +read_name length=....



Thank you for your help!
armintoepfer commented 6 months ago

We don't support that use case, sorry.