search

ParBLiSS / FastANI

Fast Whole-Genome Similarity (ANI) Estimation
Apache License 2.0
368 stars 66 forks source link

ERROR, skch::validateInputFiles #33

Open vinisalazar opened 5 years ago

vinisalazar commented 5 years ago

I'm getting the following error when trying to run FastANI:

>>>>>>>>>>>>>>>>>>
Reference = [/Users/viniWS/Bio/gtdb/fasta/NC_006576.1.fasta, /Users/viniWS/Bio/gtdb/fasta/NC_007335.2.fasta, /Users/viniWS/Bio/gtdb/fasta/NC_007513.fasta]
Query = [Bio/gtdb/fasta/NC_005042.fna]
Kmer size = 16
Fragment length = 3000
Threads = 1
ANI output file = Bio/gtdb/data/ani_test_out.txt
>>>>>>>>>>>>>>>>>>
ERROR, skch::validateInputFiles, Could not open /Users/viniWS/Bio/gtdb/fasta/NC_007513.fasta

This is the content for head /Users/viniWS/Bio/gtdb/fasta/NC_007513.fasta:

>NC_005042.1 Prochlorococcus marinus subsp. marinus str. CCMP1375 complete genome
AAAGCTAGATGGCAGAAAGGTTTTTGAATAATTTCCACAGATTCCACAAGACCTACTACT
ACTGTATTAATTTCATATAATTAAATTAGAATTACTAGAAGAAGAGAAAACTTTTATTAA
AGCTATGAAAACTTTTTGTTCCTTTTTTGGTATTTCGTAGTTATGTTGAACCGATGAAAC
TTGTTTGTTCTCAAATTGAGCTCAATACAGCTCTTCAACTAGTTAGTAGAGCTGTAGCCA
CTAGGCCTTCGCATCCAGTATTGGCAAATGTATTGCTTACTGCTGATGCGGGAACTGGAA
AACTAAGCTTAACTGGATTTGATCTTAATTTAGGAATTCAAACATCGCTTAGTGCTTCTA
TCGAAAGTAGTGGAGCAATTACAGTTCCCTCAAAACTTTTCGGAGAAATAATATCAAAAT
TATCTAGTGAATCTTCTATAACTTTATCAACAGATGATTCTAGTGAACAAGTTAATTTAA
AGAGTAAAAGTGGAAATTATCAGGTAAGAGCTATGAGTGCTGATGATTTTCCTGATTTGC

This is the content of Bio/gtdb/data/ani_test.txt:

/Users/viniWS/Bio/gtdb/fasta/NC_006576.1.fasta
/Users/viniWS/Bio/gtdb/fasta/NC_007335.2.fasta
/Users/viniWS/Bio/gtdb/fasta/NC_007513.fasta

Any ideas why this might be happening? I did some test runs on small-ish fragments (1500 bp) and it worked fine, but when using 'real world' genomes, I always get this error.

vinisalazar commented 5 years ago

Update: when I moved to the folder the files were in and passed only the file name (instead of the global path) apparently it worked. Maybe there is a bug when parsing the path for the query file?

cjain7 commented 5 years ago

I see, which version of FastANI are you running? I had made few fixes in v1.1 to better parse the file paths.

vinisalazar commented 5 years ago

Is there a easy way to check this?

vinisalazar commented 5 years ago

I would suggest adding the version to the help screen

FeMa94 commented 1 year ago

Hello everyone, I hope someone can help me. I also have the same error when I launch FastANI to compute single query vs single reference genome:

`./fastANI -q /FastANI/2020_fna -r /FastANI/ZF129_fna -o fastani.out

Reference = [/FastANI/ZF129_fna] Query = [/FastANI/2020_fna] Kmer size = 16 Fragment length = 3000 Threads = 1 ANI output file = fastani.out

ERROR, skch::validateInputFiles, Could not open /FastANI/2020_fna`

fna files were generated with Prokka, is it correct to use these files? I'm currently using FastANI v. 1.33

cjain7 commented 1 year ago

/FastANI/ZF129_fna does not look like a correct path.

On linux or Mac OS, you can go inside the folder where your fasta file is saved in the terminal, and then use echo $PWD to figure out the absolute path of the folder.

Example:

$ echo $PWD
/home/scratch/projects

Then use /home/scratch/projects/NAMEOFYOURGENOMEFILE for -q and -r options