search

PatrickKueck / FASconCAT-G

FASconCAT-G offers a wide range of possibilities to edit and concatenate multiple nucleotide, amino acid, and structure sequence alignment files for phylogenetic and population genetic purposes. The main options include sequence renaming, file format conversion, sequence translation, consensus generation of predefined sequence blocks, and RY coding as well as site exclusions in nucleotide sequences. FASconCAT-G implemented process options can be invoked in any combination and performed during a single process run. FASconCAT-G can also read in and handle different file formats (FASTA, CLUSTAL, and PHYLIP) in a single run.
32 stars 20 forks source link

File-Error: file is empty #5

Open EvaAndreaS opened 3 years ago

EvaAndreaS commented 3 years ago

I get a "file is empty"-error, but files are not empty. It should be correct fasta syntax, I double checked line-breaks. In Notepad I did EOL Conversion to Unix (LF). Always the same error:

!FILE-ERROR!: new3.fas is empty! Label not found for "next READING" at C:\Program Files\FASconCAT\FASconCAT-master\FASconCAT_v1.11.pl line 552, line 1.

Input files look like this:

new2.fas:

Name sequence 1 AGCTCCCGTCCTTTG–AGA–GTGTCCTTTCC

new3.fas:

Name sequence 1 AGCTCCCGTCCTTTGGAGAGGTGTCCTTTCC

The same problem occurs when I try to concatenate just a single file: !FILE-ERROR!: new3.fas is empty! Label not found for "next READING" at C:\Program Files\FASconCAT\FASconCAT-master\FASconCAT_v1.11.pl line 552, line 3.

Thanks for your help and effort! Eva

PatrickKueck commented 3 years ago 
            Hi Eva,Something seems not to be ok with your fasta. If it’s not empty, maybe you missed the correct fasta format!?Sequence names in fasta format must start with a greater-sign (>). Otherwise, please can you send the original fasta for crosschecking?BestPatrick Am 09.04.21 um 09:09 schrieb EvaAndreaS

                Von: "EvaAndreaS" ***@***.***>Datum: 9. April 2021An: "PatrickKueck/FASconCAT-G" ***@***.***>Cc: "Subscribed" ***@***.***>Betreff: [PatrickKueck/FASconCAT-G] File-Error: file is empty (#5)

I get a "file is empty"-error, but files are not empty. It should be correct fasta syntax, I double checked line-breaks. In Notepad I did EOL Conversion to Unix (LF). Always the same error:

!FILE-ERROR!: new3.fas is empty!

Label not found for "next READING" at C:\Program Files\FASconCAT\FASconCAT-master\FASconCAT_v1.11.pl line 552, line 1.

Input files look like this:

new2.fas:

Name sequence 1

AGCTCCCGTCCTTTG–AGA–GTGTCCTTTCC

new3.fas:

Name sequence 1

AGCTCCCGTCCTTTGGAGAGGTGTCCTTTCC

The same problem occurs when I try to concatenate just a single file:

!FILE-ERROR!: new3.fas is empty!

Label not found for "next READING" at C:\Program Files\FASconCAT\FASconCAT-master\FASconCAT_v1.11.pl line 552, line 3.

Thanks for your help and effort! Eva

—You are receiving this because you are subscribed to this thread.Reply to this email directly, view it on GitHub, or unsubscribe.

[

{

@.***": "http://schema.org",

@.***": "EmailMessage",

"potentialAction": {

@.***": "ViewAction",

"target": "https://github.com/PatrickKueck/FASconCAT-G/issues/5",

"url": "https://github.com/PatrickKueck/FASconCAT-G/issues/5",

"name": "View Issue"

},

"description": "View this Issue on GitHub",

"publisher": {

@.***": "Organization",

"name": "GitHub",

"url": "https://github.com"

}

}

]

EvaAndreaS commented 3 years ago

Hi! The error was not in the fasta files, it is a problem with WINDOWS: I installed the program in UBUNTU and it worked, with the same fasta files. Just had to switch "filename.fasta" to "filename.fas". Anyhow, thanks for the cool program! Eva