search

Phelimb / BIGSI

BItsliced Genomic Signature Index - Efficient indexing and search in very large collections of WGS data
http://www.bigsi.io
MIT License
124 stars 13 forks source link

error running search #59

Closed samlipworth closed 5 years ago

samlipworth commented 5 years ago

Hi Phelimb,

trying to run via docker using the example data. Everything runs ok, eg. after bigsi build:

docker run -v $PWD/example-data:/data phelimb/bigsi:63768c2 bigsi build --config /data/configs/berkeleydb.yaml /data/test1.bloom /data/test2.bloom -s s1 -s s2

INFO:bigsi.cmds.build:Building index: 0/1 DEBUG:bigsi.cmds.build:Loading /data/test1.bloom/test1.bloom DEBUG:bigsi.cmds.build:Loading /data/test2.bloom/test2.bloom DEBUG:bigsi.graph.bigsi:Insert sample metadata DEBUG:bigsi.graph.bigsi:Create signature index DEBUG:bigsi.graph.index:Transpose bitarrays DEBUG:bigsi.graph.index:Insert rows DEBUG:bigsi.storage.base:set bitarrays {'result': 'success'} but then I run: docker run -v $PWD/example-data:/data phelimb/bigsi:63768c2 bigsi search --config /data/configs/berkeleydb.yaml CGGCGAGGAAGCGTTAAATCTCTTTCTGACG

I got: Traceback (most recent call last): File "/usr/local/bin/bigsi", line 11, in <module> load_entry_point('bigsi==0.3.2', 'console_scripts', 'bigsi')() File "/usr/local/lib/python3.7/dist-packages/bigsi-0.3.2-py3.7.egg/bigsi/__main__.py", line 178, in main File "hug/api.py", line 390, in hug.api.CLIInterfaceAPI.__call__ File "hug/interface.py", line 551, in hug.interface.CLI.__call__ File "hug/interface.py", line 547, in hug.interface.CLI.__call__ File "hug/interface.py", line 100, in hug.interface.Interfaces.__call__ File "/usr/local/lib/python3.7/dist-packages/bigsi-0.3.2-py3.7.egg/bigsi/__main__.py", line 158, in search File "/usr/local/lib/python3.7/dist-packages/bigsi-0.3.2-py3.7.egg/bigsi/graph/bigsi.py", line 133, in __init__ File "/usr/local/lib/python3.7/dist-packages/bigsi-0.3.2-py3.7.egg/bigsi/graph/index.py", line 23, in __init__ File "/usr/local/lib/python3.7/dist-packages/bigsi-0.3.2-py3.7.egg/bigsi/matrix/bitmatrix.py", line 16, in __init__ File "/usr/local/lib/python3.7/dist-packages/bigsi-0.3.2-py3.7.egg/bigsi/storage/base.py", line 67, in get_integer File "/usr/local/lib/python3.7/dist-packages/bigsi-0.3.2-py3.7.egg/bigsi/storage/base.py", line 21, in __getitem__ File "/usr/local/lib/python3.7/dist-packages/bsddb3/__init__.py", line 239, in __getitem__ return _DeadlockWrap(lambda: self.db[key]) # self.db[key] File "/usr/local/lib/python3.7/dist-packages/bsddb3/dbutils.py", line 67, in DeadlockWrap return function(*_args, **_kwargs) File "/usr/local/lib/python3.7/dist-packages/bsddb3/__init__.py", line 239, in <lambda> return _DeadlockWrap(lambda: self.db[key]) # self.db[key] KeyError: b'number_of_rows:int' Not sure why this is?

samlipworth commented 5 years ago

Working fine after following your linux instructions instead so I'll close this - sorry.

YulongNiu commented 3 years ago

@samlipworth How did you fixed the problem? I got the same error message when running phelimb/bigsi:63768c2 and search.

iqbal-lab commented 3 years ago

Could you try this repo, which is maintained now? https://github.com/iqbal-lab-org/BIGSI

YulongNiu commented 3 years ago

@iqbal-lab Thank you. I open a new issue at https://github.com/iqbal-lab-org/BIGSI/issues/8