search

PierreBSC / Viral-Track

MIT License
54 stars 27 forks source link

Can't obtain any result #15

Closed AbdulkaderA closed 2 years ago

AbdulkaderA commented 3 years ago

Hello Everyone, First, thanks a lot for your efforts to make viral-Track available for the community. I am running Viral_Track_scanning.R as follow: Rscript Viral_Track_scanning.R parameters.txt target_files.txt

The contents of target_files.txt: /mnt/d/scRNAseq_Linux/Genome/BD1-Mock2-GEX_100_R2_extracted.fastq.gz /mnt/d/scRNAseq_Linux/Genome/BD2-WT718-GEX_100_R2_extracted.fastq.gz

The contents of parameters.txt: N_thread=1 Output_directory="/mnt/d/scRNAseq_Linux/Genome/Test_Viral_Track/" Index_genome="/mnt/d/scRNAseq_Linux/Genome/ref_genom/" Viral_annotation_file="/mnt/d/scRNAseq_Linux/Genome/Virusite_annotation_file.txt" Name_run="VSV_Viral_Test" Load_STAR_module=FALSE Load_samtools_module=FALSE Load_stringtie_module=FALSE Minimal_read_mapped=50

This is what I had:

Loading of the libraries.... ... done ! Warning message: In read.table(Parameter_target_files, header = F, sep = "\t") : incomplete final line found by readTableHeader on 'target_files.txt' 2 Fastq files are going to be processed ! Mapping BD1-Mock2-GEX_100_R2.fastq file Jan 14 12:41:20 ..... started STAR run Jan 14 12:41:20 ..... loading genome Jan 14 12:45:42 ..... started 1st pass mapping Jan 14 12:45:43 ..... finished 1st pass mapping Jan 14 12:45:43 ..... started mapping Jan 14 12:45:43 ..... finished mapping Jan 14 12:45:45 ..... started sorting BAM Jan 14 12:45:46 ..... finished successfully Mapping ofBD1-Mock2-GEX_100_R2.fastq done ! Mapping BD2-WT718-GEX_100_R2.fastq file Jan 14 12:45:46 ..... started STAR run Jan 14 12:45:46 ..... loading genome Jan 14 12:50:29 ..... started 1st pass mapping Jan 14 12:50:30 ..... finished 1st pass mapping Jan 14 12:50:31 ..... started mapping Jan 14 12:50:33 ..... finished mapping Jan 14 12:50:35 ..... started sorting BAM Jan 14 12:50:35 ..... finished successfully Mapping ofBD2-WT718-GEX_100_R2.fastq done ! All fastq files have been mapped successfully Starting the BAM file analysis Indexing of the bam file for BD1-Mock2-GEX_100_R2 is done Computing stat file for the bam file for BD1-Mock2-GEX_100_R2 is done Checking the mapping quality of each virus... Export of the viral SAM file done for BD1-Mock2-GEX_100_R2 Error in colnames<-(*tmp*, value = c("N_reads", "N_unique_reads", : attempt to set 'colnames' on an object with less than two dimensions Calls: colnames<- -> colnames<- Execution halted

The content of BD2-WT718-GEX_100_R2_extracted_Log.final.out : Started job on | Jan 14 12:26:29 Started mapping on | Jan 14 12:31:00 Finished on | Jan 14 12:31:03 Mapping speed, Million of reads per hour | 0.00

                      Number of input reads |   0
                  Average input read length |   0
                                UNIQUE READS:
               Uniquely mapped reads number |   0
                    Uniquely mapped reads % |   0.00%
                      Average mapped length |   0.00
                   Number of splices: Total |   0
        Number of splices: Annotated (sjdb) |   0
                   Number of splices: GT/AG |   0
                   Number of splices: GC/AG |   0
                   Number of splices: AT/AC |   0
           Number of splices: Non-canonical |   0
                  Mismatch rate per base, % |   -nan%
                     Deletion rate per base |   0.00%
                    Deletion average length |   0.00
                    Insertion rate per base |   0.00%
                   Insertion average length |   0.00
                         MULTI-MAPPING READS:
    Number of reads mapped to multiple loci |   0
         % of reads mapped to multiple loci |   0.00%
    Number of reads mapped to too many loci |   0
         % of reads mapped to too many loci |   0.00%
                              UNMAPPED READS:

Number of reads unmapped: too many mismatches | 0 % of reads unmapped: too many mismatches | 0.00% Number of reads unmapped: too short | 0 % of reads unmapped: too short | 0.00% Number of reads unmapped: other | 0 % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00%

Nothing Mapped!!!

Any help with that would be much appreciated.

Thanks!

PierreBSC commented 3 years ago

Hi, It basically seems that not alignement is done as it took less than a second to map your reads, in addition no reads are detected according to the log of STAR. Have you checked rigorously the fastq files you are using as an input ? Best

Pierre

AbdulkaderA commented 3 years ago

Hello Pierre, Thanks a lot for your reply. This is what I obtain after the third step of UMI tools: $ zcat BD2-WT718-GEX_S21_R2_001_extracted_fastq.gz | head -n4 @A00154:634:HT2GYDRXX:1:1101:4833:1000_GCTGCTTCACAATGATAG_GAAGAGCCGA 2:N:0:ACAATTCA GGTGAGGCGGGGGGGCGAGCCCCGAGGGGCTCTCGCTTCTGGCGCCAAGCGCCCGGCCGCGCGCCGGCCGGGCGCGACCCGCTCCGG + FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF

Do you think that there is a problem?

Many thanks in advance.

Abdulkader

PierreBSC commented 3 years ago

Okay so if the .fastq file is ok then you have to look at the reference Index you used. It says that it took a second to load it so maybe that's where you should check !

AbdulkaderA commented 3 years ago

Thanks for your reply. This is a second attempt and it says the same:

Mapping BD2-WT718-GEX_S21_R2_001_extracted.fastq file Feb 03 16:02:19 ..... started STAR run Feb 03 16:02:19 ..... loading genome Feb 03 16:14:43 ..... started 1st pass mapping Feb 03 16:14:51 ..... finished 1st pass mapping Feb 03 16:15:45 ..... started mapping Feb 03 16:16:02 ..... finished mapping Feb 03 16:16:10 ..... started sorting BAM Feb 03 16:16:11 ..... finished successfully Mapping ofBD2-WT718-GEX_S21_R2_001_extracted.fastq done ! All fastq files have been mapped successfully Starting the BAM file analysis Indexing of the bam file for BD2-WT718-GEX_S21_R2_001_extracted is done Computing stat file for the bam file for BD2-WT718-GEX_S21_R2_001_extracted is done Checking the mapping quality of each virus... Export of the viral SAM file done for BD2-WT718-GEX_S21_R2_001_extracted Error in colnames<-(*tmp*, value = c("N_reads", "N_unique_reads", : attempt to set 'colnames' on an object with less than two dimensions Calls: colnames<- -> colnames<- Execution halted

PierreBSC commented 3 years ago

Hi Abdulkader,

This is really weird... Can you describe me a bit :

Pierre

AbdulkaderA commented 3 years ago

Hello Pierre, I am very sorry for the delay in replying to your feedback. First of all, and just to let you know, we tested our scRNAseq libraries if we can detect a specific viral gene by qPCR. The result was positive, the viral gene came out after 20 cycles compared to 40 in the negative control.

Now, to come back to your questions, I am using Ubuntu 20.04.2 LTS under windows, and the R version used in Ubuntu is 4.0.4 Regarding the fastq files: they are coming from bovine CD8 T cells infected or not with Alcelaphine herpesvirus1 (the genome of this virus is present in your database). I re-run it again and I obtain nothing!!

Any idea why it does not work?

If you prefer, I can provide you a fastq file to have a try.

Many thanks in advance.

Best

Abdulkader

PierreBSC commented 3 years ago

Hi Abdulkader,

Sure no problem, we are living in harsh/hectic times ! I do not thing the problem has anything to do with the virus itself, and as you said the viral load seems to be quite high (which makes sense for an in-vitro infection).

The problems definitely comes from the aligner. Here is what I would suggest :

  1. Download/subsample a small fastq file and align it using STAR directly. If this does not work then check STAR itself.
  2. If this work then check the target_file.txt : I am pretty sure the problems comes from there. Check that it has exactly the same structure as this file : https://github.com/PierreBSC/Viral-Track/blob/master/Files_to_process.txt
  3. If this still does not work you can send me a sample of the data ! Best

Pierre

AbdulkaderA commented 3 years ago

Hi Pierre,

I followed your recommendations but nothing is working!! May be something with my coding or my computer.

Can I send you a sample form my files that you try it from your side? Hopefully it will work, I am pretty confident about that 😉

Many thanks in advance for your help.

Best.

Abdulkader

PierreBSC commented 2 years ago

Problem solved, closing.

mohebg commented 1 year ago

@AbdulkaderA , @PierreBSC May you please let me know how this issue was solved - I am facing a similar problem