Some tRNA sequences get a large number of hits which causes a problem for sequence search, for example this sequence currently crashes it: GCGGAAGUAGUUCAGUGGUAGAACACCACCUUGCCAAGGUGGGGGUCGCGGGUUCGAAUCCCGUCUUCCGCUCCA.
This is not surprising given that we have >4 million tRNA sequences.
Let's try the same strategy as we used for rRNAs. For example, the following query whitelists ~110,000 tRNAs that excludes millions of sequences only found in ENA or Rfam:
Some tRNA sequences get a large number of hits which causes a problem for sequence search, for example this sequence currently crashes it:
GCGGAAGUAGUUCAGUGGUAGAACACCACCUUGCCAAGGUGGGGGUCGCGGGUUCGAAUCCCGUCUUCCGCUCCA
.This is not surprising given that we have >4 million tRNA sequences.
Let's try the same strategy as we used for rRNAs. For example, the following query whitelists ~110,000 tRNAs that excludes millions of sequences only found in ENA or Rfam:
https://rnacentral.org/search?q=rna_type:%22tRNA%22%20and%20(expert_db:%22gtRNAdb%22%20or%20expert_db:%22refseq%22%20or%20expert_db:%22ensembl%22%20or%20expert_db:%22hgnc%22%20or%20expert_db:%22flybase%22%20or%20expert_db:%22wormbase%22%20or%20expert_db:%22pombase%22%20or%20expert_db:%22TAIR%22%20or%20expert_db:%22SGD%22%20or%20expert_db:%22MGI%22%20or%20expert_db:%22dictybase%22%20or%20expert_db:%22PDBe%22)
@blakesweeney - would it be possible to create a set of, say, 5
whitelist-trna
files and makeall-except-rrna-trna
instead ofall-except-rrna
files?