carlosribas
commented
1 month ago Hi @hamzaaitabbou96,
Thank you for your interest in RNAcentral.
You can sort results in different ways when using the sequence search on our site, such as by e-value, identity, query coverage, and target coverage. By default, the results are sorted by e-value. We also prioritise displaying results from certain species first, for example Homo sapiens (9606) and Mus musculus (10090).
In brief, here’s what these terms mean:
- Identity: The percentage of identical matches between the query sequence and the target sequence over the aligned region.
- Query coverage: The percentage of the query sequence that is included in the alignment with the target sequence.
- Target coverage: The percentage of the target sequence that is included in the alignment with the query sequence.
- Alignment sequence: The specific portion of the query sequence that aligns with the target sequence, indicating the region of similarity between the two sequences.
- Species priority: Some species have higher priority in search results. You can see the logic used in this part of the code.
If you require any further information, feel free to contact me.
hamzaaitabbou96
Hi, I have a question about RNAcentral results, for similar sequences I got a list of 959 results how can I select the most similar ones. And what is the meaning of these variables : "identity": 87.5, "query_coverage": 92.3076923076923, "target_coverage": 0.4903964037597058, "alignment_sequence": "GCAGAGAUGUACUACAAGAAGCGU", "species_priority": "d",