search

RobertsLab / resources

https://robertslab.github.io/resources/
19 stars 11 forks source link

translating assembled metagenome contigs in NGLess #526

Closed emmats closed 5 years ago

emmats commented 5 years ago

I've contacted the developer of NGLess with this question, but it has been about a week and he hasn't responded so I'm hoping someone here can help! I have managed to successfully assemble metagenome sequencing reads using NGLess, but I need them translated into protein sequences. This is feasible, but I'm having trouble figuring out how to incorporate the command into the script. I am using NGLess 0.10.0: https://ngless.readthedocs.io/en/latest/

Here is my script:

ngless "0.10"
input = fastq('/net/nunn/vol1/emmats/sequencing/geo_metaG/Library_Geoduck_MG_1_$
output = preprocess(input, keep_singles=False) using |read|:
   read = substrim(read, min_quality=25)
   if len(read) < 45:
     discard
contigs = assemble(input)
write(contigs, ofile='contigs.fa')
orfs = orf_find(contigs, is_metagenome=True)
write(contigs, ofile='orf.fna’)

And here is what Luis has told me about including a protein translation step in the script: If you already have the nucleotides, maybe it's easiest to translate those, but from orf_find, you can specify a file "prots_out="

http://ngless.embl.de/Functions.html#orf_find

kubu4 commented 5 years ago

If you have a FastA, I'd just use TransDecoder (it's different software).

However, I'll look into your specific issue later today and see if I can figure something out.

emmats commented 5 years ago

I'm familiar with transdecoder, but I think I have read in the past that it should not be used with metagenomes.

sr320 commented 5 years ago

maybe change the orfs= line. Based on documentation I might have used select.

ngless "0.10"
input = fastq('/net/nunn/vol1/emmats/sequencing/geo_metaG/Library_Geoduck_MG_1_$
output = preprocess(input, keep_singles=False) using |read|:
   read = substrim(read, min_quality=25)
   if len(read) < 45:
     discard
contigs = assemble(input)
write(contigs, ofile='contigs.fa')
orfs = select(contigs, is_metagenome=True)
write(contigs, ofile='orf.fna’)
emmats commented 5 years ago

I've tried the following and neither worked. orfs = orf_find(contigs, is_metagenome=True, prots_out=proteins.fa) write(contigs, ofile='orf.fna’)

orfs = orf_find(contigs, is_metagenome=True, prots_out=True) write(contigs, ofile='orf.fna')

kubu4 commented 5 years ago

Do you get an error message or does nothing happen at all?

On Mon, Dec 31, 2018, 09:25 emmats <notifications@github.com wrote:

I've tried the following and neither worked. orfs = orf_find(contigs, is_metagenome=True, prots_out=proteins.fa) write(contigs, ofile='orf.fna’)

orfs = orf_find(contigs, is_metagenome=True, prots_out=True) write(contigs, ofile='orf.fna')

— You are receiving this because you commented. Reply to this email directly, view it on GitHub https://github.com/RobertsLab/resources/issues/526#issuecomment-450671643, or mute the thread https://github.com/notifications/unsubscribe-auth/AEThOA6gU4pfGNHTjNKuOjHt3GoQZZQTks5u-kiVgaJpZM4ZljGc .

sr320 commented 5 years ago

Yes, but neither of these are what I suggested :)

emmats commented 5 years ago

@sr320 I was hoping you would clarify your suggestion...

@kubu4 I get a fatal error and it does not run

sr320 commented 5 years ago

@emmats Its in the code I posted above.. and below 

ngless "0.10"
input = fastq('/net/nunn/vol1/emmats/sequencing/geo_metaG/Library_Geoduck_MG_1_$
output = preprocess(input, keep_singles=False) using |read|:
   read = substrim(read, min_quality=25)
   if len(read) < 45:
     discard
contigs = assemble(input)
write(contigs, ofile='contigs.fa')
orfs = select(contigs, is_metagenome=True)
write(contigs, ofile='orf.fna’)
emmats commented 5 years ago

But that doesn't include the prots_out argument that Luis mentioned and that is in the manual. It seems that the only thing that is different is that you changed orf_find to select.

kubu4 commented 5 years ago

The error message just says ,"Fatal error"?

On Mon, Dec 31, 2018, 09:35 emmats <notifications@github.com wrote:

But that doesn't include the prots_out argument that Luis mentioned and that is in the manual. It seems that the only thing that is different is that you changed orf_find to select.

— You are receiving this because you were mentioned. Reply to this email directly, view it on GitHub https://github.com/RobertsLab/resources/issues/526#issuecomment-450672625, or mute the thread https://github.com/notifications/unsubscribe-auth/AEThOA2B3_BtRUohX2RMFU8TzaNHuij3ks5u-krlgaJpZM4ZljGc .

emmats commented 5 years ago

Exiting after fatal error while loading and running script Script Error ^[[31mError in type-checking (line 11): Bad argument type in function 'orf_f$

^[[0m [Wed 19-12-2018 14:04:52]: # Configuration [Wed 19-12-2018 14:04:52]: download base URL: http://ngless.embl.de/res$ [Wed 19-12-2018 14:04:52]: global data directory: /net/gs/vol3/software$ [Wed 19-12-2018 14:04:52]: user directory: /net/maccoss/vol5/home/emmat$ [Wed 19-12-2018 14:04:52]: user data directory: /net/maccoss/vol5/home/$ [Wed 19-12-2018 14:04:52]: temporary directory: /data/scratch/ssd [Wed 19-12-2018 14:04:52]: keep temporary files: True [Wed 19-12-2018 14:04:52]: create report: True [Wed 19-12-2018 14:04:52]: report directory: /net/nunn/vol1/emmats/sequ$ [Wed 19-12-2018 14:04:52]: color setting: AutoColor [Wed 19-12-2018 14:04:52]: print header: True [Wed 19-12-2018 14:04:52]: subsample: False [Wed 19-12-2018 14:04:52]: verbosity: Normal [Wed 19-12-2018 14:04:52]: search path: [Wed 19-12-2018 14:04:52]: Loading modules...

sr320 commented 5 years ago

Correct that is all I changed- does that still give error?

you can try orfs = select(contigs, is_metagenome=True, prots_out=/path/to/file)

emmats commented 5 years ago

That still gives an error:

Exiting after fatal error while loading and running script Script Error ^[[31mError in type-checking (line 11): Bad argument 'is_metagenome' for function 'select'. This function takes the following arguments: keep_if drop_if paired __oname

Error in type-checking (line 11): Bad argument 'prots_out' for function 'select'. This function takes the following arguments: keep_if drop_if paired __oname

Error in type-checking (line 11): Bad type in function call (function 'select' expects NGLMappedReadSet got NGLString).

sr320 commented 5 years ago

just guessing now.... but what error does this produce?

ngless "0.10"
input = fastq('/net/nunn/vol1/emmats/sequencing/geo_metaG/Library_Geoduck_MG_1_$
output = preprocess(input, keep_singles=False) using |read|:
   read = substrim(read, min_quality=25)
   if len(read) < 45:
     discard
contigs = assemble(input)
write(contigs, ofile='contigs.fna')
orfs = orf_find(contigs)
write(contigs, ofile='orfs.fna')
kubu4 commented 5 years ago

It looks like your error messages are cut off. Can you please post the full message from your original script?

kubu4 commented 5 years ago

Also, have you posted the full script? The error message indicates a problem at line 11, but your original script only has 10 lines.

emmats commented 5 years ago

It may have been the wrong error messages. I'm being lazy and not saving all of them for each attempt.

@sr320 why leave out the is_metagenome argument? Here is the error for that: gcc/4.9.1(9):ERROR:151: Module 'gcc/4.9.1' depends on one of the module(s) 'gmp/5.0.2' gcc/4.9.1(9):ERROR:102: Tcl command execution failed: prereq gmp/5.0.2

gcc/8.1.0(5):ERROR:150: Module 'gcc/8.1.0' conflicts with the currently loaded module(s) 'mpc/1.1.0' gcc/8.1.0(5):ERROR:102: Tcl command execution failed: conflict mpc

Exiting after fatal error while loading and running script Script Error ^[[31mError on line 11: Function orf_find requires argument is_metagenome. ^[[0m [Mon 31-12-2018 11:15:45]: # Configuration [Mon 31-12-2018 11:15:45]: download base URL: http://ngless.embl.de/resources/ [Mon 31-12-2018 11:15:45]: global data directory: /net/gs/vol3/software/modules-sw/ngless/0.10.0/Linux/RHEL6/x86_64/bin/../share/n$ [Mon 31-12-2018 11:15:45]: user directory: /net/maccoss/vol5/home/emmats/.local/share/ngless [Mon 31-12-2018 11:15:45]: user data directory: /net/maccoss/vol5/home/emmats/.local/share/ngless/data [Mon 31-12-2018 11:15:45]: temporary directory: /data/scratch/ssd [Mon 31-12-2018 11:15:45]: keep temporary files: True [Mon 31-12-2018 11:15:45]: create report: True [Mon 31-12-2018 11:15:45]: report directory: /net/nunn/vol1/emmats/sequencing/geo_metaG/test.ngl2.output_ngless [Mon 31-12-2018 11:15:45]: color setting: AutoColor [Mon 31-12-2018 11:15:45]: print header: True [Mon 31-12-2018 11:15:45]: subsample: False [Mon 31-12-2018 11:15:45]: verbosity: Normal [Mon 31-12-2018 11:15:45]: search path: [Mon 31-12-2018 11:15:45]: Loading modules...

sr320 commented 5 years ago

just pieces together stuff from online doc.

what is error for ...

ngless "0.10"
input = fastq('/net/nunn/vol1/emmats/sequencing/geo_metaG/Library_Geoduck_MG_1_$
output = preprocess(input, keep_singles=False) using |read|:
   read = substrim(read, min_quality=25)
   if len(read) < 45:
     discard
contigs = assemble(input)
write(contigs, ofile='contigs.fna')
orfs = orf_find(contigs, is_metagenome=True)
write(contigs, ofile='orfs.fna')
emmats commented 5 years ago

That appears to be my original script. There is no error and it runs fine, it just doesn't give me a protein file, only nucleotides.

sr320 commented 5 years ago

But it give you orf.fna?

emmats commented 5 years ago

I get orf.fna and contigs.fa

Here is the beginning of the orf.fna file

k141_1 flag=1 multi=202.0000 len=317 GACTTTAAAGAGTATACGAAAGTCTTAGCTTCTAAAGACATCAAAATTTATAAAGAAATTTTTAAAATTCAGAATAAGCCTATTAAAAATAAAAAAGCTCGAGATTGGAAAAAAATTGATGTCCTTATCAAAAAATTGGATAATAAAATATTATTGGGTAACGTCTATGCTGAGAGATATTTGCATCCAACGGGTTGGAGAAGTTCTTATAAAGACTTAAAAATATGGCTCGACAAATATAATGATCACCCAGACGCTACAAGAATTTCCAGAATAGCATTAAAAAGAAAACCTAACAATGTAAGGAGTCCTAAAGC k141_2 flag=1 multi=4.0000 len=380 AATATCATCTAATAAACCTAAAGGCATATCTTGACTAACACCACCTGGACGTATATATGCTGCATGCATCCGAGCACCGGATACACGTTCATAAAATTCCATTAATTTTTCACGTTCTTCAAATACCCAAAGTAATGGTGTTGTTGCACCAACATCTAAGGCATGTGTTGAAACAGCAAGTAAATGGTTTAAAATACGTGTTATTTCACAAAATAAGACTCTAATATACTGAGCACGTTTTGGGACTGAACAATTTAATAATTTTTCAACCGCAAGAGAATACGCATGCTCTTGTGCCATCATAGAAACGTAATCAAGCCTATCAAAATAAGGCAATGCTTGTATATAGTTTTTATGTTCAATTAATTTTTCAGTACCTC k141_3 flag=1 multi=1809.0000 len=308 GATAGGAGTCCGTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTTTTTGCTGCGATTGCGGCGGGATTTGCGACTTTACTGACGCCTTGCGTGTTCCCAATGATTCCGGTAACTATTTCGTATTTCACGAAACGCGCTGAATCAGGTAAAGGCACGCCGTTAGGTAATGCTACGGCTTATGCGAGCGGTATTGTCTTTACATTTGCCGGCATTGGAGTTGGCGCAGCACTAGCGCTGTCTCTTATACACATCTCCGAGCCCACGAGACGGACTCCTATCTCGTATGCCGTCTTCTGCTTGAAAAAA k141_4 flag=1 multi=3.0000 len=315 GGTCCGCGACATGCTCGACAACGCCTATCGCTACCTGATCGACCACGATCGACTGGTGTTCTTCGGCCCCAACTCGATGGTGCTGGGCGGTTTTCGCGACGCCAGCTGACTCGGCCAGTGTTCATCGGGGCGATCAGCGACTCCGGTTGTCCCTCCTGGGCGCGGTACTCGAGATGTCGGCCGCAGCGCGGCTTGCATGATGCAGGCAGGATCGCAGGCTGTGCTTTCGCTGTTGGAAGCGATCCAGCCACCGGGGATGGATCGCCACCACGCGCACCGGAACGCTGGCCAATCCCAGCAATTGCACGATGGCCA k141_5 flag=1 multi=1184.0000 len=300 GAGATAGGAGTCCGTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCCTTTACAGCTTCAGCTAGAATATCTACACCTTCTAACATTTGAGCACGTGCATTTGCACCAAATTTGACTTCTTTAGCAGCCATTTTATCGTCCTTTCAAATTGTAACGTAATTTTTTAAATAAAAGAATAAATTAACCCATTATTCCCATGATATCGCTTTCTTTCATGATCAATAGATCTTTTCCATCAAGCTTAACTTCAGTACCGGACCATTTTCCAAAAAGTACAACATCACCTTCTTTAACATCTA

sr320 commented 5 years ago

how about

ngless "0.10"
input = fastq('/net/nunn/vol1/emmats/sequencing/geo_metaG/Library_Geoduck_MG_1_$
output = preprocess(input, keep_singles=False) using |read|:
   read = substrim(read, min_quality=25)
   if len(read) < 45:
     discard
contigs = assemble(input)
write(contigs, ofile='contigs.fna')
orfs = orf_find(contigs, is_metagenome=True, prots_out='prot.fa')
write(contigs, ofile='orfs.fna')
sr320 commented 5 years ago

If you have orf fasta (which you do) it should just be a straight translation...?

a la https://www.ebi.ac.uk/Tools/st/emboss_transeq/

using frame 1 and bacteria...

emmats commented 5 years ago

I know, but wouldn't it be nice to have it all in the same pipeline so that when I am processing all the files I only have to run the command once?

Here is the error for your most recent script suggestion: gcc/4.9.1(9):ERROR:151: Module 'gcc/4.9.1' depends on one of the module(s) 'gmp/5.0.2' gcc/4.9.1(9):ERROR:102: Tcl command execution failed: prereq gmp/5.0.2

gcc/8.1.0(5):ERROR:150: Module 'gcc/8.1.0' conflicts with the currently loaded module(s) 'mpc/1.1.0' gcc/8.1.0(5):ERROR:102: Tcl command execution failed: conflict mpc

Exiting after fatal error while loading and running script Script Error ^[[31mError in type-checking (line 11): Bad argument type in function 'orf_find', variable "prots_out". Expected NGLFilename got NGLString.

^[[0m [Mon 31-12-2018 11:43:15]: # Configuration [Mon 31-12-2018 11:43:15]: download base URL: http://ngless.embl.de/resources/ [Mon 31-12-2018 11:43:15]: global data directory: /net/gs/vol3/software/modules-sw/ngless/0.10.0/Linux/RHEL6/x86_64/bin/../share/ngless/data [Mon 31-12-2018 11:43:15]: user directory: /net/maccoss/vol5/home/emmats/.local/share/ngless [Mon 31-12-2018 11:43:15]: user data directory: /net/maccoss/vol5/home/emmats/.local/share/ngless/data [Mon 31-12-2018 11:43:15]: temporary directory: /data/scratch/ssd [Mon 31-12-2018 11:43:15]: keep temporary files: True [Mon 31-12-2018 11:43:15]: create report: True [Mon 31-12-2018 11:43:15]: report directory: /net/nunn/vol1/emmats/sequencing/geo_metaG/test.ngl2.output_ngless [Mon 31-12-2018 11:43:15]: color setting: AutoColor [Mon 31-12-2018 11:43:15]: print header: True [Mon 31-12-2018 11:43:15]: subsample: False [Mon 31-12-2018 11:43:15]: verbosity: Normal [Mon 31-12-2018 11:43:15]: search path: [Mon 31-12-2018 11:43:15]: Loading modules...

sr320 commented 5 years ago

This generally is bothersome

gcc/4.9.1(9):ERROR:151: Module 'gcc/4.9.1' depends on one of the module(s) 'gmp/5.0.2'
gcc/4.9.1(9):ERROR:102: Tcl command execution failed: prereq    gmp/5.0.2

gcc/8.1.0(5):ERROR:150: Module 'gcc/8.1.0' conflicts with the currently loaded module(s) 'mpc/1.1.0'
gcc/8.1.0(5):ERROR:102: Tcl command execution failed: conflict mpc

and might or might not be related.

One problem is it does like 'prot.fa'

as per 

Script Error
^[[31mError in type-checking (line 11): Bad argument type in function 'orf_find', variable "prots_out". Expected NGLFilename got NGLString.

'prot.fa' must be a NGLString

I am not sure how to make it a NGLFilename (this is part of the coding).

you could try 'prot.faa'

emmats commented 5 years ago

I got those errors even for the one that ran to completion (without a protein translation argument).

I got the same error when I tried prot.faa

I guess I can just give up and use a tool outside of the NGL pipeline...

kubu4 commented 5 years ago

I finally had a chance to sit down and look at this. This is your issue:

contigs = assemble(input)
write(contigs, ofile='contigs.fa')
orfs = orf_find(contigs, is_metagenome=True)
write(contigs, ofile='orf.fna’)

The second write command is writing the nucleotide data (contigs) to your designated output file (orf.fna).

You need to write the variable orfs to the output file, like so:

write(orfs, ofile='orf.fna’)

That should get you your protein translations in your orf.fna file.

emmats commented 5 years ago

Nope, that still yields just a nucleotide sequence file. I think "prots_out" needs to be in there somewhere. You did better than Steven, though, because it did run.

kubu4 commented 5 years ago

Fix your original script:

orfs = orf_find(contigs, is_metagenome=True, prots_out=True)
write(orfs, ofile='orf.fna')
emmats commented 5 years ago

I have tried that before, but will try again.

emmats commented 5 years ago

It failed immediately.

emmats commented 5 years ago

Exiting after fatal error while loading and running script Script Error ^[[31mError in type-checking (line 11): Bad argument type in function 'orf_find', variable "prots_out". Expected NGLFilename got NGLBool.

kubu4 commented 5 years ago

Sorry, I took that prots_out=True from one of your examples above. I just looked at documentation and you need a file path (as indicated in error message). Please try:

orfs = orf_find(contigs, is_metagenome=True, prots_out=proteins.fna)
write(orfs, ofile='orf.fna')
emmats commented 5 years ago

Here is the error for that suggestion:

Exiting after fatal error while loading and running script Script Error ^[[31mParsing error on file '/net/nunn/vol1/emmats/sequencing/geo_metaG/test.ngl2' on line 11 (column 6)

    write(contigs, ofile='contigs.fna')

    orfs = orf_find(contigs, is_metagenome=True, prots_out=proteins.fna)
    --------------^
    write(orfs, ofile='orf.fna')

"/net/nunn/vol1/emmats/sequencing/geo_metaG/test.ngl2" (line 11, column 6): unexpected ("/net/nunn/vol1/emmats/sequencing/geo_metaG/test.ngl2" (line 11, column 6),TOperator '=') expecting if (reserved word), discard (reserved word), continue (reserved word), variable, len (reserved word), operator -, not (reserved word), operator (, function call, operator [ or end of input

I tried the same thing but with quotes around 'proteins.fna' and got this error: Exiting after fatal error while loading and running script Script Error ^[[31mError in type-checking (line 11): Bad argument type in function 'orf_find', variable "prots_out". Expected NGLFilename got NGLString.

kubu4 commented 5 years ago

Can you post full script so we can see what line 11 of the script is?

kubu4 commented 5 years ago

Actually, never mind. The error message is referencing the contents of your file. Can you post a snippet of your file (/net/nunn/vol1/emmats/sequencing/geo_metaG/test.ngl2)?

Please post snippet through line 11 and column 6, so we can look at what's generating the error message.

emmats commented 5 years ago

ngless "0.10" input = fastq('/net/nunn/vol1/emmats/sequencing/geo_metaG/Library_Geoduck_MG1$ output = preprocess(input, keep_singles=False) using |read|: read = substrim(read, min_quality=25) if len(read) < 45: discard

contigs = assemble(input) write(contigs, ofile='contigs.fna')

orfs = orf_find(contigs, is_metagenome=True, prots_out=proteins.fna) write(orfs, ofile='orf.fna')

kubu4 commented 5 years ago

Can you please post the full script (line 2 appears to be truncated)?

emmats commented 5 years ago

Sorry, didn't catch that. Nano is stupid.

ngless "0.10" input = fastq('/net/nunn/vol1/emmats/sequencing/geo_metaG/Library_Geoduck_MG_1_S3_L002_R1_001.fastq') output = preprocess(input, keep_singles=False) using |read|: read = substrim(read, min_quality=25) if len(read) < 45: discard

contigs = assemble(input) write(contigs, ofile='contigs.fna')

orfs = orf_find(contigs, is_metagenome=True, prots_out=proteins.fna) write(orfs, ofile='orf.fna')

kubu4 commented 5 years ago

Nano is stupid

Use cat to print contents of a file.

emmats commented 5 years ago

Well, you prefer the easy option. I like to make things hard on myself.

kubu4 commented 5 years ago

Can you post a snippet of your file (/net/nunn/vol1/emmats/sequencing/geo_metaG/test.ngl2)?

Please post snippet through line 11 and column 6, so we can look at what's generating the error message.

emmats commented 5 years ago

ngless "0.10" input = fastq('/net/nunn/vol1/emmats/sequencing/geo_metaG/Library_Geoduck_MG_1_S3_L002_R1_001.fastq') output = preprocess(input, keep_singles=False) using |read|: read = substrim(read, min_quality=25) if len(read) < 45: discard

contigs = assemble(input) write(contigs, ofile='contigs.fna')

orfs = orf_find(contigs, is_metagenome=True, prots_out=proteins.fna)

kubu4 commented 5 years ago

Wait. Is /net/nunn/vol1/emmats/sequencing/geo_metaG/test.ngl2 your script?

emmats commented 5 years ago

yes. The contents of which I have now posted twice.

kubu4 commented 5 years ago

yes. The contents of which I have now posted twice.

It wasn't clear what your script was called, since you had never previously referred to it by name.

Anyway, since it requires a file path, please try this (maybe with single and/or double quotes around the path, too):

orfs = orf_find(contigs, is_metagenome=True, prots_out=/net/nunn/vol1/emmats/sequencing/geo_metaG/proteins.fna)
emmats commented 5 years ago

Below are all the errors I got for altering the script as suggested. I'm going to start harassing Luis some more.

No quotes Exiting after fatal error while loading and running script Script Error "/net/nunn/vol1/emmats/sequencing/geometaG/test.ngl2" (line 11, column 56): unexpected '/' expecting "#", "//", "/*", "{", "'", "\"", digit, "0x", "", letter, "!=", "==", "</>", "<=", "<", ">=", ">", "+", "*", " ", tab, ";", "\r", "\n" or end of input

Single quotes Exiting after fatal error while loading and running script Script Error Error in type-checking (line 11): Bad argument type in function 'orf_find', variable "prots_out". Expected NGLFilename got NGLString.

Double quotes Exiting after fatal error while loading and running script Script Error Error in type-checking (line 11): Bad argument type in function 'orf_find', variable "prots_out". Expected NGLFilename got NGLString.

kubu4 commented 5 years ago

Alrighty, give this a shot (I feel good about this one):

ngless "0.10"
input = fastq('/net/nunn/vol1/emmats/sequencing/geo_metaG/Library_Geoduck_MG_1_S3_L002_R1_001.fastq')
output = preprocess(input, keep_singles=False) using |read|:
read = substrim(read, min_quality=25)
if len(read) < 45:
discard

contigs = assemble(input)
write(contigs, ofile='contigs.fna')
prots_out = proteins.fna
orfs = orf_find(contigs, is_metagenome=True, prots_out)
emmats commented 5 years ago

Still didn't work... Exiting after fatal error while loading and running script Script Error Parsing error on file '/net/nunn/vol1/emmats/sequencing/geo_metaG/test.ngl2' on line 10 (column 21)

contigs = assemble(input)
write(contigs, ofile='contigs.fna')
prots_out = proteins.fna
-----------------------------^
orfs = orf_find(contigs, is_metagenome=True, prots_out)

"/net/nunn/vol1/emmats/sequencing/geo_metaG/test.ngl2" (line 10, column 21): unexpected ("/net/nunn/vol1/emmats/sequencing/geo_metaG/test.ngl2" (line 10, column 21),TOperator '.') expecting if (reserved word), discard (reserved word), continue (reserved word), variable, len (reserved word), operator -, not (reserved word), operator (, function call, operator [ or end of input

I also tried it with single quotes around 'proteins.fna' Exiting after fatal error while loading and running script Script Error Parsing error on file '/net/nunn/vol1/emmats/sequencing/geo_metaG/test.ngl2' on line 11 (column 6)

write(contigs, ofile='contigs.fna')
prots_out = 'proteins.fna'
orfs = orf_find(contigs, is_metagenome=True, prots_out)
--------------^

"/net/nunn/vol1/emmats/sequencing/geo_metaG/test.ngl2" (line 11, column 6): unexpected ("/net/nunn/vol1/emmats/sequencing/geo_metaG/test.ngl2" (line 11, column 6),TOperator '=') expecting if (reserved word), discard (reserved word), continue (reserved word), variable, len (reserved word), operator -, not (reserved word), operator (, function call, operator [ or end of input

kubu4 commented 5 years ago

This problem has been fixed by the developer:

https://github.com/ngless-toolkit/ngless/issues/97

but you'll have to install the updated version:

https://github.com/ngless-toolkit/ngless/commit/e8adcc2bb170bd44489e569e4d521c8ca9195958