search

Simon-Coetzee / motifBreakR

A Package For Predicting The Disruptiveness Of Single Nucleotide Polymorphisms On Transcription Factor Binding Sites.
27 stars 12 forks source link

How large indels can motifbreakr process? #36

Open Minglc opened 2 years ago

Minglc commented 2 years ago

I used motifbreakR to score some variations (including indel), but the program reported an error. I found that it was due to the problem of the scoreSnpLst function in motifbreakR, seq.remove <- ref.len - alt.len; if (seq.remove < 0) { ref.range <- ref.range[1:(length(ref.range) + seq.remove)]; }else { alt.range <- alt.range[1:(length(alt.range) - seq.remove)]; } The ref allele of a problem variant is 'GCCACCAATACCTACATAAATCAAAAGAAATAAAACATCCAACAACCACTGGATTCA' , and the alt allele is 'ACTGTTAAATGCCA', thus the seq.remove equal 43. The length of the alt.range equal 34, thus length(alt.range) - seq.remove get an negative value and caused error. It seems that this indel is too large, and the length difference between ref and ALT is too large. I am confused about how large indels can motifbreakR process. Could you please give some suggestions?

Simon-Coetzee commented 2 years ago

Perhaps if you give me an example of the bed file with this variant in it, and the species, I can take a look and see where things are going wrong.