Open tdfy opened 4 years ago
Hi tdfy,
Again. Sorry about the late reply.
Without knowing the details of your experiment I would guess the following command can be run on each demultiplexed PB CCS fastq file.
longread_umi pacbio_pipeline \
-d demultiplexed_pb_ccs.fq \
-o test_pb_ccs \
-v 3 \
-m 3500 \ <- change to minimum amplicon length
-M 6000 \ <- change to maximum amplicon length
-s 60 \
-e 60 \
-f CAAGCAGAAGACGGCATACGAGAT \
-F AGRGTTYGATYMTGGCTCAG \ <- change if you used a different fwd target primer
-r AATGATACGGCGACCACCGAGATC \
-R CGACATCGAGGTGCCAAAC \ <- change if you used a different rev target primer
-c 2 \
-t 1 <- change to use number of CPUS available
hello, I am starting with PacBio amplicon libraries generated by a colleague which were demultiplexed using lima. Could you describe the best workflow for this starting point? Thank you.