Open scogi opened 3 years ago
Hi Stefan,
Thank you for the thorough testing. I will have a look at what is going on here.
regards Søren
Hey Stefan, Would you mind sharing the output of longread_umi_version_dump.txt ? I am finding that different sub-package versions are leading to different numbers of outputted consensus sequences.
Thanks, Ryan
Also, @scogi , do you mind letting me know how many sequences you have in test_r941/raconx3_medakax1/consensus_raconx3_medakax1.fa
? (same for R10 set too).
Thanks, Ryan
Hi Ryan, sorry, took me a while to get back to this project. Thanks for your reply.
test_r941/raconx3_medakax1/consensus_raconx3_medakax1.fa: 6 sequences test_r10 does not have this folder but only raconx2_medakax1 and ... medakax2 consensus_raconx3_medakax1.fa: 90 sequences consensus_raconx3_medakax2.fa: 90 sequences
i have not been able to locate the file longread_umi_version_dump.txt. Where should it be saved?
Thanks, Stefan
@ziels Ok, i located longread_umi_version_dump.txt. The problem is that shortly after I had posted this issue, I had to delete and reinstall anaconda completely. So, unfortunately, I do not have the file of the original installation anymore. I reinstalled longread_umi now, Updated values are:
test_r941/raconx3_medakax1/consensus_raconx3_medakax1.fa: 6 sequences test_r941/variants/variants.fa: 1 sequence
test_r10/raconx2_medakax1/consensus_raconx3_medakax1.fa: 90 sequences test_r10/raconx2_medakax2/consensus_raconx3_medakax2.fa: 90 sequences test_r10/variants/variants.fa: 12 sequences
Content of longread_umi_version_dump.txt: Script start: 2020-10-22-13:23:06 Software Version: longread_umi - seqtk - Version: 1.3-r106 Parallel - GNU parallel 20191122 Usearch - usearch v11.0.667_i86linux32 Racon - v1.4.10 Minimap2 - 2.17-r941 medaka - 1.0.1 medaka model - Gawk - GNU Awk 4.1.3, API: 1.1 Cutadapt - 2.7 Porechop - 0.2.4 + modify porechop.py Filtlong - Filtlong v0.2.0 BWA - Version: 0.7.17-r1188 Samtools - Version: 1.9 (using htslib 1.9) Bcftools - bcftools 1.9
Hi,
fantastic tool, promises to solve a lot of our problems! I managed to install it (Ubuntu 18.04, conda installation as proposed in https://github.com/SorenKarst/longread_umi/issues/36), but if I run the Quickstart examples for Nanopore data R9.4.1 and R10, i get an error message that the "-U" parameter is missing
-U is missing but required. Exiting.
I thus modified the commands to:
longread_umi nanopore_pipeline -d test_reads.fq -v 30 -o test_r941 -s 90 -e 90 -m 3500 -M 6000 -f CAAGCAGAAGACGGCATACGAGAT -F AGRGTTYGATYMTGGCTCAG -r AATGATACGGCGACCACCGAGATC -R CGACATCGAGGTGCCAAAC -c 3 -p 1 -q r941_min_high_g330 -t 1 -U r941_min_high_g360
and
longread_umi nanopore_pipeline -d ont_r10_zymo_rrna.fq -o test_r10 -v 25 -q r10_min_high_g340 -m 3500 -M 6000 -s 90 -e 90 -f CAAGCAGAAGACGGCATACGAGAT -F AGRGTTYGATYMTGGCTCAG -r AATGATACGGCGACCACCGAGATC -R CGACATCGAGGTGCCAAAC -c 2 -p 2 -t 1 -U r103_min_high_g360
which works.
However, the numbers in variants.fq and consensus_raconx3_medakax1.fa differ from what the Quick start section states
R9.4.1 variants.fq: 1 (should be 3, according to quick start section) consensus_raconx3_medakax1.fa: 6 (should be 9)
R10 variants.fq: 12 sequences (should be 13) consensus_raconx3_medakax1.fa 88 (should be 98)
My questions:
Thank you, Stefan