update el_gato 1.18.2 - Githubissues

Kincekara commented 2 months ago

There are new releases of el_gato. I run into an issue while checking 1.18.0. The developers fixed it after I submitted the issue. So, I am skipping to the bugfix 1.18.2

 $ diff elgato/1.15.2/Dockerfile elgato/1.18.2/Dockerfile 
3c3
< ARG ELGATO_VER="1.15.2"
---
> ARG ELGATO_VER="1.18.2"
30c30
<     python3 -m pip install . -vv &&\
---
>     python3 -m pip install . -vv --no-cache-dir &&\
34c34
< RUN pip install fpdf2
---
> RUN pip install --no-cache-dir fpdf2 packaging
54c54,55
< RUN el_gato.py --assembly GCF_900119765.1_2532STDY5467631_genomic.fna --out test/
---
> RUN el_gato.py --assembly GCF_900119765.1_2532STDY5467631_genomic.fna --out test/ &&\
>     cat test/run.log

Pull Request (PR) checklist:

[x] Include a description of what is in this pull request in this message.
[x] The dockerfile successfully builds to a test target for the user creating the PR. (i.e. docker build --tag samtools:1.15test --target test docker-builds/samtools/1.15 )
[x] Directory structure as name of the tool in lower case with special characters removed with a subdirectory of the version number (i.e. spades/3.12.0/Dockerfile)
- [ ] (optional) All test files are located in same directory as the Dockerfile (i.e. shigatyper/2.0.1/test.sh)
[x] Create a simple container-specific README.md in the same directory as the Dockerfile (i.e. spades/3.12.0/README.md)
- [ ] If this README is longer than 30 lines, there is an explanation as to why more detail was needed
[x] Dockerfile includes the recommended LABELS
[x] Main README.md has been updated to include the tool and/or version of the dockerfile(s) in this PR
[x] Program_Licenses.md contains the tool(s) used in this PR and has been updated for any missing

erinyoung commented 2 months ago

Tests ran successfully

#12 [test 3/3] RUN el_gato.py --assembly GCF_900119765.1_2532STDY5467631_genomic.fna --out test/ &&    cat test/run.log
#12 0.732 GCF_900119765.1_2532STDY5467631_genomic   62  8   10  3   15  18  1   6
#12 0.742 [07/30/2024 03:39:34 PM | test/ ]  Starting preprocessing
#12 0.742 [07/30/2024 03:39:34 PM | test/ ]  User supplied the assembly file, adopting the alignment/in silico pcr route
#12 0.742 [07/30/2024 03:39:34 PM | test/ ]  New output directory created
#12 0.742 [07/30/2024 03:39:34 PM | test/ ]  Checking if all the prerequisite programs are installed
#12 0.742 [07/30/2024 03:39:34 PM | test/ ]  Checking for program minimap2
#12 0.742 [07/30/2024 03:39:34 PM | test/ ]  minimap2 version is 2.24-r1122
#12 0.742 [07/30/2024 03:39:34 PM | test/ ]  Checking for program samtools
#12 0.742 [07/30/2024 03:39:34 PM | test/ ]  samtools version is samtools 1.13
#12 0.742 [07/30/2024 03:39:34 PM | test/ ]  Checking for program makeblastdb
#12 0.742 [07/30/2024 03:39:34 PM | test/ ]  makeblastdb version is makeblastdb: 2.12.0+
#12 0.742 [07/30/2024 03:39:34 PM | test/ ]  Checking for program blastn
#12 0.742 [07/30/2024 03:39:34 PM | test/ ]  blastn version is blastn: 2.12.0+
#12 0.742 [07/30/2024 03:39:34 PM | test/ ]  Checking for program isPcr
#12 0.742 [07/30/2024 03:39:34 PM | test/ ]  isPcr version is 33x2
#12 0.742 [07/30/2024 03:39:34 PM | test/ ]  All prerequisite programs are accessible
#12 0.742 [07/30/2024 03:39:34 PM | test/ ]  Checking if all the required input files exist
#12 0.742 [07/30/2024 03:39:34 PM | test/ ]  Input files are present
#12 0.742 [07/30/2024 03:39:34 PM | test/ ]  Ensuring thread counts are correct
#12 0.742 [07/30/2024 03:39:34 PM | test/ ]  Thread count has been validated
#12 0.742 [07/30/2024 03:39:34 PM | test/ ]  All reference files have been discovered
#12 0.742 [07/30/2024 03:39:34 PM | test/ ]  Parameters input:
#12 0.742                 Read 1      None
#12 0.742                 Read 2      None
#12 0.742                 Assembly    GCF_900119765.1_2532STDY5467631_genomic.fna
#12 0.742                 Threads     1
#12 0.742                 Out Prefix  test/
#12 0.742                 Log file    test/run.log
#12 0.742                 SBT         /usr/local/bin/db
#12 0.742                 Profile     /usr/local/bin/db/lpneumophila.txt
#12 0.742                 Verbose     False
#12 0.742                 Overwrite   False
#12 0.742                 Depth       10
#12 0.742 
#12 0.742 
#12 0.742 [07/30/2024 03:39:34 PM | test/ ]  Starting analysis
#12 0.742 [07/30/2024 03:39:34 PM | test/ ]  Running command: isPcr GCF_900119765.1_2532STDY5467631_genomic.fna /usr/local/bin/db/mompS_primer1.tab stdout -out=fa -minPerfect=5 -tileSize=6 -maxSize=1200 -stepSize=5
#12 0.742 [07/30/2024 03:39:34 PM | test/ ]  Running mompS2 primer1
#12 0.742 [07/30/2024 03:39:34 PM | test/ ]  Command log for mompS2 primer1:
#12 0.742                                                                                              
#12 0.742 >NZ_LT632614.1:3483454-3484167 mompS_1 714bp TTGACCATGAGTGGGATTGG TGGATAAATTATCCAGCCGGACTTC  
#12 0.742 TTGACCATGAGTGGGATTGGggcttcaaattagaaggttcttatcacttc                                           
#12 0.742 aatactggtaatgacatcaatgtgaactggtatcattttgataatgacag                                           
#12 0.742 cgatcactgggctgattttgctaactggcacaactacaacaacaagtggg                                           
#12 0.742 atgctgttaatgctgaattaggtcaattcgtagatttcagcgctaacaag                                           
#12 0.742 aaaatgcgtttccacggcggtgttcaatacgctcgcattgaagctgatgt                                           
#12 0.742 gaaccgttatttcaataactttgcctttaacgggttcaactctaagttca                                           
#12 0.742 atggctttggtcctcgcactggtttagacatgaactatgtatttggcaat                                           
#12 0.742 ggctttggtgtttatgctaaaggagctgctgctattctggttggtaccag                                           
#12 0.742 cgatttctacgatggaatcaacttcattaatggctctaaaaatgccatcg                                           
#12 0.742 ttcctgagttagaagctaagcttggtgctgattacacttacgcaatggct                                           
#12 0.742 caaggcgatttgactttagacgttggttacatgtggtttaactacttcaa                                           
#12 0.742 cgctatgcacaatactggcgtatttaatggatttgaaactgatttcgcag                                           
#12 0.742 ggctttggtgtttatgctaaaggagctgctgctattctggttggtaccag
#12 0.742 cgatttctacgatggaatcaacttcattaatggctctaaaaatgccatcg
#12 0.742 ttcctgagttagaagctaagcttggtgctgattacacttacgcaatggct
#12 0.742 caaggcgatttgactttagacgttggttacatgtggtttaactacttcaa
#12 0.742 cgctatgcacaatactggcgtatttaatggatttgaaaCTGATTTCGCAG
#12 0.742 CTTCTG
#12 0.742 [07/30/2024 03:39:34 PM | test/ ]  Running command: blastn -query - -db /usr/local/bin/db/all_loci.fasta -outfmt '6 std qlen slen sseqid' -max_target_seqs 50000 | awk -F'\t' '{OFS=FS}{gsub(/_.+/, "", $15)}1' | sort -k15,15 -k12,12gr | sort -u  -k15,15
#12 0.742 [07/30/2024 03:39:34 PM | test/ ]  Running blastn/mompS
#12 0.742 [07/30/2024 03:39:34 PM | test/ ]  Command log for blastn/mompS:
#12 0.742 qseqid                               sseqid    pident   length  mismatch  gapopen  qstart  qend  sstart  send  evalue  bitscore  qlen  slen  sseqid  
#12 0.742 NZ_LT632614.1:3483454-3484167:1+606  mompS_18  100.000  352     0         0        94      445   1       352   0.0     651       606   352   mompS   
#12 0.742                                      
#12 0.742 
#12 0.742 [07/30/2024 03:39:34 PM | test/ ]  Finished running blastn/mompS
#12 0.742 [07/30/2024 03:39:34 PM | test/ ]  mompS alleles identified: 18
#12 0.742 [07/30/2024 03:39:34 PM | test/ ]  Running command: blastn -query GCF_900119765.1_2532STDY5467631_genomic.fna -db /usr/local/bin/db/all_loci.fasta -outfmt '6 std qlen slen' -max_target_seqs 50000
#12 0.742 [07/30/2024 03:39:34 PM | test/ ]  Running blast
#12 0.742 [07/30/2024 03:39:34 PM | test/ ]  Finished running blast
#12 0.742 [07/30/2024 03:39:34 PM | test/ ]  Command log for blast:
#12 0.742 qseqid         sseqid        pident   length  mismatch  gapopen  qstart   qend     sstart  send  evalue     bitscore  qlen     slen  
#12 0.742 NZ_LT632614.1  flaA_8        100.000  182     0         0        [1498](https://github.com/StaPH-B/docker-builds/actions/runs/10165445650/job/28113247523?pr=1026#step:8:1504)635  1498816  182     1     2.16e-90   337       3530817  182   
#12 0.742 NZ_LT632614.1  pilE_10       100.000  333     0         0        721006   721338   333     1     2.48e-174  616       3530817  333   
#12 0.742 NZ_LT632614.1  asd_3         100.000  473     0         0        2650534  2651006  473     1     0.0        874       3530817  473   
#12 0.742 NZ_LT632614.1  mip_15        100.000  402     0         0        941537   941938   1       402   0.0        743       3530817  402   
#12 0.742 NZ_LT632614.1  proA_1        100.000  405     0         0        568377   568781   1       405   0.0        749       3530817  405   
#12 0.742 NZ_LT632614.1  neuA_neuAH_6  100.000  354     0         0        898051   898404   1       354   0.0        654       3530817  354   
#12 0.742                
#12 0.742 
#12 0.742 [07/30/2024 03:39:34 PM | test/ ]  Finished running blast
#12 0.742 [07/30/2024 03:39:34 PM | test/ ]  Finished analysis
#12 0.742 [07/30/2024 03:39:34 PM | test/ ]  Output = 
#12 0.742 GCF_900119765.1_2532STDY5467631_genomic   62  8   10  3   15  18  1   6
#12 0.742 
#12 0.742 [07/30/2024 03:39:34 PM | test/ ]  The program took 0s
#12 DONE 0.7s

erinyoung commented 2 months ago

Thank you for putting this together!

You can check the status of the deploy here : https://github.com/StaPH-B/docker-builds/actions/runs/10170535753

StaPH-B / docker-builds

update el_gato 1.18.2 #1026