Closed goksel closed 3 years ago
In addition, the encoding property value should come from Table 1 in the spec.
I've made this update as recommended (see PR #406), but the current approach for highlighted syntax could be rethought. Maybe there is a LaTeX package to enable this?
The entities in the RDF example start with "#" and the base URL ends with #, causing the double use of the # character. The following example may work: @prefix sbol: http://sbols.org/v3# . @base http://example.com# . @prefix : http://example.com# .
:pLac a sbol:Component ; sbol:name "pLac" ; sbol:description "lactose inducible promoter" ; sbol:sequence :sequence .
:sequence a sbol:Sequence ; sbol:encoding http://www.chem.qmul.ac.uk/iubmb/misc/naseq.html ; sbol:elements "caatacgcaaaccgcctctccccgcgc" .