search

SynBioDex / SBOL-specification

The Synthetic Biology Open Language (SBOL)
http://sbolstandard.org
14 stars 9 forks source link

SBOL RDF serialisation example (section 8) should be fixed #392

Closed goksel closed 3 years ago

goksel commented 3 years ago

The entities in the RDF example start with "#" and the base URL ends with #, causing the double use of the # character. The following example may work: @prefix sbol: http://sbols.org/v3# . @base http://example.com# . @prefix : http://example.com# .

:pLac a sbol:Component ; sbol:name "pLac" ; sbol:description "lactose inducible promoter" ; sbol:sequence :sequence .

:sequence a sbol:Sequence ; sbol:encoding http://www.chem.qmul.ac.uk/iubmb/misc/naseq.html ; sbol:elements "caatacgcaaaccgcctctccccgcgc" .

goksel commented 3 years ago

In addition, the encoding property value should come from Table 1 in the spec.

chofski commented 3 years ago

I've made this update as recommended (see PR #406), but the current approach for highlighted syntax could be rethought. Maybe there is a LaTeX package to enable this?