search

SynBioDex / SBOL-specification

The Synthetic Biology Open Language (SBOL)
http://sbolstandard.org
13 stars 9 forks source link

Explicitly explain reverse orientation location interpretation #454

Closed jakebeal closed 3 years ago

jakebeal commented 3 years ago

We don't currently explain which way people should interpret a reverse orientation location.

We should explain that we are using the GenBank style interpretation in which the reversing happens after the range selection (rather than the opposite order). For example, in the following sequence:

AAAAACCCCCTTTTTGGGGGTTTTTGGGGG

Range: 1-6, reverse will get you "AAAAAC" to be reverse complemented to "GTTTTT"