search

Synbiota / GENtle2

GENtle2 - Web-Based DNA Editor for Synthetic Biology
https://synbiota.com
100 stars 37 forks source link

Deletion of last codon in PCR primer when converting an RDP CDS part without a stop codon #212

Closed wujpatrick closed 9 years ago

wujpatrick commented 9 years ago

Consider this file: https://drive.google.com/open?id=0ByXvyYl_LHxpS1ZJOGVpUTc5QW8

Note that the last codon (Asn, AAC) is not present but the second-last codon (Lys, AAA) is still there.

capture

I suspect it's because the source sequence for this part already had the stop codon deleted: https://drive.google.com/open?id=0ByXvyYl_LHxpYnowNHhVb3NJN3M

DesireeSy commented 9 years ago

Not sure if this is you or if it's James.

AJamesPhillips commented 9 years ago

The part is already an RDP part... or at least it already has stickyEnds. We currently don't handle this case.

DesireeSy commented 9 years ago

Patrick, are they trying to build a composite part?

If so, we need to cover this use case separately for designer.

AJamesPhillips commented 9 years ago

In the RDP PCR window. If you choose bases 12 to 842 it behaves as expected.

edited_luxr_circuit_07-jul-2015-rdp-rdp___gentle

AJamesPhillips commented 9 years ago

Please reopen if I've missed anything.

wujpatrick commented 9 years ago

Yes, this is a composite part. It is a promoter-RBS-CDS.

They removed the stop codon in their source sequence prior to the creation of primers. GENtle added a start codon and made the end a C. However, the final codon disappears. It's not intended.

Patrick Wu Sales and Account Manager www.synbiota.com

Sent from mobile On Jul 8, 2015 12:05 PM, "Desirée Sy" notifications@github.com wrote:

Patrick, are they trying to build a composite part?

If so, we need to cover this use case separately for designer.

— Reply to this email directly or view it on GitHub https://github.com/Synbiota/GENtle2/issues/212#issuecomment-119680338.

AJamesPhillips commented 9 years ago

When you can, could you run me through the steps to recreate this behaviour please? If I try to create a new RDP part from the sequence posted, without changing the from and to values, it doesn't work because the sequence is not a multiple of 3.

AJamesPhillips commented 9 years ago 
<sybil>
<session>
<circuit>
<sequence type="dna" name="Edited LuxR Circuit 07-Jul-2015" circular="false">ACCTGTAGGATCGTACAGGTTTACGCAAGAAAATGGTTTGTTATAGTCGAATAAATACTAGAGAAAGAGGAGAAATACTAGATGAAAAACATAAATGCCGACGACACATACAGAATAATTAATAAAATTAAAGCTTGTAGAAGCAATAATGATATTAATCAATGCTTATCTGATATGACTAAAATGGTACATTGTGAATATTATTTACTCGCGATCATTTATCCTCATTCTATGGTTAAATCTGATATTTCAATCCTAGATAATTACCCTAAAAAATGGAGGCAATATTATGATGACGCTAATTTAATAAAATATGATCCTATAGTAGATTATTCTAACTCCAATCATTCACCAATTAATTGGAATATATTTGAAAACAATGCTGTAAATAAAAAATCTCCAAATGTAATTAAAGAAGCGAAAACATCAGGTCTTATCACTGGGTTTAGTTTCCCTATTCATACGGCTAACAATGGCTTCGGAATGCTTAGTTTTGCACATTCAGAAAAAGACAACTATATAGATAGTTTATTTTTACATGCGTGTATGAACATACCATTAATTGTTCCTTCTCTAGTTGATAATTATCGAAAAATAAATATAGCAAATAATAAATCAAACAACGATTTAACCAAAAGAGAAAAAGAATGTTTAGCGTGGGCATGCGAAGGAAAAAGCTCTTGGGATATTTCAAAAATATTAGGTTGCAGTGAGCGTACTGTCACTTTCCATTTAACCAATGCGCAAATGAAACTCAATACAACAAACCGCTGCCAAAGTATTTCTAAAGCAATTTTAACAGGAGCAATTGATTGCCCATACTTTAAAAAT</sequence>
</circuit>
</session>
</sybil>

If you try to make a part out of this sequence the trailing AAC (converted from AAT) is dropped.