Open albenstein opened 1 year ago
Hi @albenstein. Could you share the command and a few lines of your input files?
Command is below:
source miRDP2-v1.1.4_pipeline.bash --bowtie2 -g /cta/users/kkahraman/Fungi_wheat/mirdp2/Data/iwgsc_refseqv2.1_assembly.fa -x /cta/users/kkahraman/Fungi_wheat/mirdp2/Data/Wheat_bowtie_index -f -i /cta/users/kkahraman/Fungi_wheat/mirdp2/Data/HankControl_mirdp2input.fa -o /cta/users/kkahraman/Fungi_wheat/mirdp2/Data/
Input file:
read0_x19440 CATATCGGGTAGGTTGTGGTATTTCATTGC read1_x20539 TAATTCATGATCTGGCATGA read2_x98 ACAAAAACTATAATAAAGGGGA read3_x95783 GGTAGTTCGACCGCGGAAT
Based on your input file, I suspect it is not in .fa format. Could you try reformatting it by adding a ">" in each sequence name? The reformatted file should look like this:
read0_x19440 CATATCGGGTAGGTTGTGGTATTTCATTGC read1_x20539 TAATTCATGATCTGGCATGA read2_x98 ACAAAAACTATAATAAAGGGGA read3_x95783 GGTAGTTCGACCGCGGAAT
There are ">" characters in each sequence, github is changing them to command.
Got it. After taking a second look at your command, it seems that it is different from what's used in the pipeline in this GitHub page. You should be able to run it if you strictly follow step 1. miRNA prediction using miRDeep-P2. The command you've used has not been tested in this pipeline.
Dear Sir or Madam, We're using miRDP2 on our HPC system. We're getting this error below when we run pipeline.bash: Could you please help on this issue?
Use of uninitialized value $id in hash element at /cta/capps/mirdeep-p2/1.1.4/scripts/convert_SAM_to_blast.pl line 87. Use of uninitialized value $id in hash element at /cta/capps/mirdeep-p2/1.1.4/scripts/convert_SAM_to_blast.pl line 87. Use of uninitialized value $id in hash element at /cta/capps/mirdeep-p2/1.1.4/scripts/mod-miRDP.pl line 1222. Use of uninitialized value $id in hash element at /cta/capps/mirdeep-p2/1.1.4/scripts/mod-miRDP.pl line 1223. Use of uninitialized value $id in hash element at /cta/capps/mirdeep-p2/1.1.4/scripts/mod-miRDP.pl line 1224. Use of uninitialized value $id in hash element at /cta/capps/mirdeep-p2/1.1.4/scripts/mod-miRDP.pl line 1225. Use of uninitialized value $subject_old in hash element at /cta/capps/mirdeep-p2/1.1.4/scripts/mod-miRDP.pl line 688. Use of uninitialized value $lng in numeric le (<=) at /cta/capps/mirdeep-p2/1.1.4/scripts/mod-miRDP.pl line 694. Use of uninitialized value $subject_old in hash element at /cta/capps/mirdeep-p2/1.1.4/scripts/mod-miRDP.pl line 789. Use of uninitialized value $subject_old in hash element at /cta/capps/mirdeep-p2/1.1.4/scripts/mod-miRDP.pl line 790. Use of uninitialized value $subject_old in hash element at /cta/capps/mirdeep-p2/1.1.4/scripts/mod-miRDP.pl line 791. Use of uninitialized value $query in hash element at /cta/capps/mirdeep-p2/1.1.4/scripts/mod-miRDP.pl line 1046. Use of uninitialized value $query in hash element at /cta/capps/mirdeep-p2/1.1.4/scripts/mod-miRDP.pl line 1047. Use of uninitialized value $query in hash element at /cta/capps/mirdeep-p2/1.1.4/scripts/mod-miRDP.pl line 1036. Use of uninitialized value $end in numeric le (<=) at /cta/capps/mirdeep-p2/1.1.4/scripts/mod-miRDP.pl line 1090. Use of uninitialized value $beg in numeric le (<=) at /cta/capps/mirdeep-p2/1.1.4/scripts/mod-miRDP.pl line 1090. Use of uninitialized value in numeric le (<=) at /cta/capps/mirdeep-p2/1.1.4/scripts/mod-miRDP.pl line 1094. Use of uninitialized value $beg in numeric le (<=) at /cta/capps/mirdeep-p2/1.1.4/scripts/mod-miRDP.pl line 1094. Use of uninitialized value $strand in string eq at /cta/capps/mirdeep-p2/1.1.4/scripts/mod-miRDP.pl line 1097. Use of uninitialized value $beg in subtraction (-) at /cta/capps/mirdeep-p2/1.1.4/scripts/mod-miRDP.pl line 1100. Use of uninitialized value $beg in subtraction (-) at /cta/capps/mirdeep-p2/1.1.4/scripts/mod-miRDP.pl line 1100. Use of uninitialized value $end in subtraction (-) at /cta/capps/mirdeep-p2/1.1.4/scripts/mod-miRDP.pl line 1100. Use of uninitialized value $seq in substr at /cta/capps/mirdeep-p2/1.1.4/scripts/mod-miRDP.pl line 1100. Use of uninitialized value $end in numeric le (<=) at /cta/capps/mirdeep-p2/1.1.4/scripts/mod-miRDP.pl line 1114. Use of uninitialized value $beg in numeric le (<=) at /cta/capps/mirdeep-p2/1.1.4/scripts/mod-miRDP.pl line 1114. Use of uninitialized value in numeric le (<=) at /cta/capps/mirdeep-p2/1.1.4/scripts/mod-miRDP.pl line 1118. Use of uninitialized value $beg in numeric le (<=) at /cta/capps/mirdeep-p2/1.1.4/scripts/mod-miRDP.pl line 1118. Use of uninitialized value $strand in string eq at /cta/capps/mirdeep-p2/1.1.4/scripts/mod-miRDP.pl line 1121. Use of uninitialized value $beg in subtraction (-) at /cta/capps/mirdeep-p2/1.1.4/scripts/mod-miRDP.pl line 1124. Use of uninitialized value $beg in subtraction (-) at /cta/capps/mirdeep-p2/1.1.4/scripts/mod-miRDP.pl line 1124. Use of uninitialized value $end in subtraction (-) at /cta/capps/mirdeep-p2/1.1.4/scripts/mod-miRDP.pl line 1124. Use of uninitialized value $struct in substr at /cta/capps/mirdeep-p2/1.1.4/scripts/mod-miRDP.pl line 1124. Use of uninitialized value $strand in string eq at /cta/capps/mirdeep-p2/1.1.4/scripts/mod-miRDP.pl line 955. Use of uninitialized value $end in numeric le (<=) at /cta/capps/mirdeep-p2/1.1.4/scripts/mod-miRDP.pl line 1090. Use of uninitialized value $beg in numeric le (<=) at /cta/capps/mirdeep-p2/1.1.4/scripts/mod-miRDP.pl line 1090. Use of uninitialized value in numeric le (<=) at /cta/capps/mirdeep-p2/1.1.4/scripts/mod-miRDP.pl line 1094. Use of uninitialized value $beg in numeric le (<=) at /cta/capps/mirdeep-p2/1.1.4/scripts/mod-miRDP.pl line 1094. Use of uninitialized value $strand in string eq at /cta/capps/mirdeep-p2/1.1.4/scripts/mod-miRDP.pl line 1097. Use of uninitialized value $beg in subtraction (-) at /cta/capps/mirdeep-p2/1.1.4/scripts/mod-miRDP.pl line 1100. Use of uninitialized value $beg in subtraction (-) at /cta/capps/mirdeep-p2/1.1.4/scripts/mod-miRDP.pl line 1100. Use of uninitialized value $end in subtraction (-) at /cta/capps/mirdeep-p2/1.1.4/scripts/mod-miRDP.pl line 1100. Use of uninitialized value $seq in substr at /cta/capps/mirdeep-p2/1.1.4/scripts/mod-miRDP.pl line 1100.