search

Teichlab / bracer

BraCeR - reconstruction of B cell receptor sequences from single-cell RNAseq data
Other
41 stars 22 forks source link

Keep track of ambiguity? #33

Closed scharch closed 5 years ago

scharch commented 5 years ago

Here is partial output of a cell from filtered_BCR_seqs/fitlered_BCRs.txt:

------------------
test
------------------
BCR_H recombinants: 0/1
BCR_K recombinants: 0/2
BCR_L recombinants: 0/0

#BCR_H#
##TRINITY_DN0_c0_g1_i2##
V segment:      IGHV1-3*01,IGHV3-11*04,IGHV3-11*06,IGHV3-21*01,IGHV3-30*01,IGHV3-30*03,IGHV3-30*04,IGHV3-30*05,IGHV3-30*06,IGHV3-30*07,IGHV3-30*09,IGHV3-30*10,IGHV3-30*11,IGHV3-30*13,IGHV3-30*14,IGHV3-30*15,IGHV3-30*16,IGHV3-30*17,IGHV3-30*19,IGHV3-30-3*01
D segment:      IGHD6-13*01
J segment:      IGHJ4*02
C segment:      IGHG1*03
ID:     IGHV1-3_TGTGCGAGAGATCTCTGGGTGGACTCGCAGCAGCCACCGGGGCACTTCTGG_IGHJ4
TPM:    1020.28
Productive:     False
Stop codon:     False
In frame:       False
Full length:    False
Sequence length:        465
All possible V genes:   IGHV1-3, IGHV3-11, IGHV3-21, IGHV3-30, IGHV3-30-3
All possible J genes:   IGHJ4, IGHJ5

Segment query_id        subject_id      % identity      alignment length        mismatches      gap opens       gaps    q start q end   s start s end   e value bit score
V       reversed|TRINITY_DN0_c0_g1_i2   IGHV1-3*01      96.154  26      1       0       0       1       26      271     296     1.32e-04        39.2
V       reversed|TRINITY_DN0_c0_g1_i2   IGHV3-11*04     96.154  26      1       0       0       1       26      271     296     1.32e-04        39.2
V       reversed|TRINITY_DN0_c0_g1_i2   IGHV3-11*06     96.154  26      1       0       0       1       26      271     296     1.32e-04        39.2
V       reversed|TRINITY_DN0_c0_g1_i2   IGHV3-21*01     96.154  26      1       0       0       1       26      271     296     1.32e-04        39.2
V       reversed|TRINITY_DN0_c0_g1_i2   IGHV3-30*01     96.154  26      1       0       0       1       26      271     296     1.32e-04        39.2
V       reversed|TRINITY_DN0_c0_g1_i2   IGHV3-30*03     96.154  26      1       0       0       1       26      271     296     1.32e-04        39.2

Does bracer keep track of this ambiguity in V gene assignment when doing lineage analysis? That is, if another cell in the sample from the same lineage captures enough of the V gene to resolve it as, say VH3-21, will that get picked up despite the use of VH1-3 in the ID for this cell?

idalind commented 5 years ago

Hi @scharch , Yes bracer normally does keep track of ambiguity in V gene assignments. As long as the list of possible V genes between cells overlaps with at least one V gene, the sequences will be tested for clonality. However, since the chain in this case seems to be nonproductive, bracer will not look at clonality between the chains.